Incidental Mutation 'R3932:Pde5a'
ID308491
Institutional Source Beutler Lab
Gene Symbol Pde5a
Ensembl Gene ENSMUSG00000053965
Gene Namephosphodiesterase 5A, cGMP-specific
SynonymsPDE5A1, Pde5
MMRRC Submission 040919-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.388) question?
Stock #R3932 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location122728947-122859374 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122760896 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 212 (E212K)
Ref Sequence ENSEMBL: ENSMUSP00000143042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066728] [ENSMUST00000200389]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066728
AA Change: E244K

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000069011
Gene: ENSMUSG00000053965
AA Change: E244K

DomainStartEndE-ValueType
Blast:GAF 64 152 4e-42 BLAST
GAF 154 314 2.23e-31 SMART
GAF 336 503 9.8e-28 SMART
HDc 600 768 8.11e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198314
Predicted Effect probably damaging
Transcript: ENSMUST00000200389
AA Change: E212K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143042
Gene: ENSMUSG00000053965
AA Change: E212K

DomainStartEndE-ValueType
Blast:GAF 32 120 3e-42 BLAST
GAF 122 282 1.1e-33 SMART
GAF 304 471 4.7e-30 SMART
HDc 568 736 4.4e-11 SMART
Meta Mutation Damage Score 0.3425 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cGMP-binding, cGMP-specific phosphodiesterase, a member of the cyclic nucleotide phosphodiesterase family. This phosphodiesterase specifically hydrolyzes cGMP to 5'-GMP. It is involved in the regulation of intracellular concentrations of cyclic nucleotides and is important for smooth muscle relaxation in the cardiovascular system. Alternative splicing of this gene results in three transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b2 C T 7: 81,473,850 probably benign Het
Arl1 C T 10: 88,733,536 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp10a T C 7: 58,827,104 M1189T possibly damaging Het
BC051142 A G 17: 34,443,443 T86A possibly damaging Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
Cdc34b G A 11: 94,742,615 V214M probably benign Het
Cfap54 T C 10: 92,829,757 T2985A probably benign Het
Clcc1 T C 3: 108,673,366 M332T probably damaging Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ctdnep1 A G 11: 69,989,574 probably benign Het
Edar C T 10: 58,610,342 C221Y probably damaging Het
Fam135b T A 15: 71,450,431 Q1295L probably benign Het
Fam184a C T 10: 53,699,301 A71T probably damaging Het
Fbxw10 A G 11: 62,869,157 probably benign Het
Frmd4a T C 2: 4,537,260 W247R probably damaging Het
Gcn1l1 A G 5: 115,587,834 H553R probably benign Het
Grin3a C T 4: 49,672,472 probably null Het
H2-Q6 C T 17: 35,425,566 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Med10 A G 13: 69,809,982 N18D probably damaging Het
Mgat4b T A 11: 50,233,338 H368Q possibly damaging Het
Morn5 C A 2: 36,053,023 T45N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Myrf T C 19: 10,218,151 T432A probably damaging Het
Nav3 T A 10: 109,694,035 E2148D probably damaging Het
Nfe2l3 A G 6: 51,456,615 T236A possibly damaging Het
Odc1 T A 12: 17,548,800 F227Y probably benign Het
Olfr1444 T C 19: 12,862,630 M285T possibly damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Pdcd1 T C 1: 94,041,264 I110V probably benign Het
Plin4 A G 17: 56,106,704 I307T probably benign Het
Rag1 T C 2: 101,643,039 Y586C probably damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rgs9 A G 11: 109,275,813 probably benign Het
Rin3 A G 12: 102,390,083 D961G probably damaging Het
Rubcn A G 16: 32,829,259 probably null Het
Slc13a2 T A 11: 78,398,400 Y495F probably damaging Het
Tfec T A 6: 16,845,459 D67V probably damaging Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Tmem94 T C 11: 115,789,254 M30T probably benign Het
Tubgcp6 A G 15: 89,104,414 probably benign Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r85 T C 10: 130,418,467 M783V probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Zfp94 T G 7: 24,303,687 D110A probably benign Het
Other mutations in Pde5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Pde5a APN 3 122794357 missense probably damaging 1.00
IGL00945:Pde5a APN 3 122835642 critical splice donor site probably null
IGL01395:Pde5a APN 3 122817955 missense probably benign 0.40
IGL01872:Pde5a APN 3 122794369 critical splice donor site probably null
IGL01947:Pde5a APN 3 122835610 missense probably damaging 1.00
IGL02033:Pde5a APN 3 122803061 missense possibly damaging 0.51
IGL02209:Pde5a APN 3 122825015 splice site probably benign
IGL02220:Pde5a APN 3 122748382 missense probably benign 0.05
IGL02301:Pde5a APN 3 122760885 missense probably damaging 1.00
IGL02748:Pde5a APN 3 122760892 missense probably damaging 0.99
R0009:Pde5a UTSW 3 122824902 splice site probably benign
R0031:Pde5a UTSW 3 122803055 missense probably benign 0.00
R0119:Pde5a UTSW 3 122748458 missense probably damaging 1.00
R0390:Pde5a UTSW 3 122835583 missense probably damaging 1.00
R0481:Pde5a UTSW 3 122818077 splice site probably benign
R0499:Pde5a UTSW 3 122748458 missense probably damaging 1.00
R0657:Pde5a UTSW 3 122748458 missense probably damaging 1.00
R0845:Pde5a UTSW 3 122729331 missense probably benign 0.28
R0908:Pde5a UTSW 3 122779001 missense probably benign 0.01
R1147:Pde5a UTSW 3 122794313 missense probably damaging 1.00
R1147:Pde5a UTSW 3 122794313 missense probably damaging 1.00
R1553:Pde5a UTSW 3 122778936 missense probably benign 0.14
R1728:Pde5a UTSW 3 122748240 missense probably damaging 1.00
R1744:Pde5a UTSW 3 122747897 missense probably damaging 0.97
R1774:Pde5a UTSW 3 122729364 missense probably benign 0.01
R1784:Pde5a UTSW 3 122748240 missense probably damaging 1.00
R2437:Pde5a UTSW 3 122843053 missense probably damaging 1.00
R2844:Pde5a UTSW 3 122851708 missense probably damaging 1.00
R2897:Pde5a UTSW 3 122779002 missense probably benign 0.03
R2936:Pde5a UTSW 3 122794319 missense probably damaging 0.97
R3160:Pde5a UTSW 3 122781628 nonsense probably null
R3162:Pde5a UTSW 3 122781628 nonsense probably null
R3704:Pde5a UTSW 3 122779019 missense probably benign 0.00
R3847:Pde5a UTSW 3 122803160 missense probably damaging 0.98
R4387:Pde5a UTSW 3 122729352 missense probably benign 0.00
R4613:Pde5a UTSW 3 122823093 missense probably damaging 1.00
R4676:Pde5a UTSW 3 122747893 missense possibly damaging 0.67
R5034:Pde5a UTSW 3 122852586 missense probably damaging 1.00
R5034:Pde5a UTSW 3 122852587 missense probably damaging 1.00
R5358:Pde5a UTSW 3 122748176 missense probably damaging 1.00
R5394:Pde5a UTSW 3 122818009 missense probably damaging 1.00
R5502:Pde5a UTSW 3 122803032 missense probably damaging 1.00
R5821:Pde5a UTSW 3 122817955 missense probably benign 0.40
R5932:Pde5a UTSW 3 122841044 missense probably benign 0.01
R6063:Pde5a UTSW 3 122824925 missense probably benign 0.23
R6190:Pde5a UTSW 3 122729307 missense probably benign 0.28
R6815:Pde5a UTSW 3 122824924 missense probably benign 0.01
R6940:Pde5a UTSW 3 122779032 missense possibly damaging 0.53
R7274:Pde5a UTSW 3 122855246 nonsense probably null
R7337:Pde5a UTSW 3 122748458 missense probably damaging 1.00
R7384:Pde5a UTSW 3 122825000 missense probably damaging 1.00
R7480:Pde5a UTSW 3 122803148 missense possibly damaging 0.50
R7508:Pde5a UTSW 3 122818030 missense probably damaging 1.00
R7522:Pde5a UTSW 3 122840999 nonsense probably null
R7623:Pde5a UTSW 3 122774601 missense probably benign
R8153:Pde5a UTSW 3 122852576 missense probably benign 0.30
R8153:Pde5a UTSW 3 122852578 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAGATGCTATGGGCTTACATG -3'
(R):5'- GCTTCTCAATAGTCAAGGGAAATCC -3'

Sequencing Primer
(F):5'- TGGGCTTACATGATTTTAATGCC -3'
(R):5'- AATCCTCTATTTACCATTCAACACTG -3'
Posted On2015-04-17