Incidental Mutation 'R3932:Grin3a'
ID308492
Institutional Source Beutler Lab
Gene Symbol Grin3a
Ensembl Gene ENSMUSG00000039579
Gene Nameglutamate receptor ionotropic, NMDA3A
SynonymsNR3A, A830097C19Rik, NMDAR-L
MMRRC Submission 040919-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3932 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location49661611-49845744 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 49672472 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076674] [ENSMUST00000093859]
Predicted Effect probably null
Transcript: ENSMUST00000076674
SMART Domains Protein: ENSMUSP00000075970
Gene: ENSMUSG00000039579

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 161 181 N/A INTRINSIC
Lig_chan-Glu_bd 557 622 9.62e-22 SMART
PBPe 565 910 1.43e-73 SMART
transmembrane domain 934 956 N/A INTRINSIC
coiled coil region 1063 1105 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000093859
SMART Domains Protein: ENSMUSP00000091381
Gene: ENSMUSG00000039579

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 161 181 N/A INTRINSIC
Lig_chan-Glu_bd 557 622 9.62e-22 SMART
PBPe 565 910 1.43e-73 SMART
transmembrane domain 934 956 N/A INTRINSIC
coiled coil region 1083 1125 N/A INTRINSIC
Meta Mutation Damage Score 0.9501 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the N-methyl-D-aspartate (NMDA) receptors, which belong to the superfamily of glutamate-regulated ion channels, and function in physiological and pathological processes in the central nervous system. This subunit shows greater than 90% identity to the corresponding subunit in rat. Studies in the knockout mouse deficient in this subunit suggest that this gene may be involved in the development of synaptic elements by modulating NMDA receptor activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene display increased current densities in some cerebrocortical neurons of the brain, increased levels of prepulse inhibition, and altered dendritic spine morphology. Otherwise, they display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b2 C T 7: 81,473,850 probably benign Het
Arl1 C T 10: 88,733,536 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp10a T C 7: 58,827,104 M1189T possibly damaging Het
BC051142 A G 17: 34,443,443 T86A possibly damaging Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
Cdc34b G A 11: 94,742,615 V214M probably benign Het
Cfap54 T C 10: 92,829,757 T2985A probably benign Het
Clcc1 T C 3: 108,673,366 M332T probably damaging Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ctdnep1 A G 11: 69,989,574 probably benign Het
Edar C T 10: 58,610,342 C221Y probably damaging Het
Fam135b T A 15: 71,450,431 Q1295L probably benign Het
Fam184a C T 10: 53,699,301 A71T probably damaging Het
Fbxw10 A G 11: 62,869,157 probably benign Het
Frmd4a T C 2: 4,537,260 W247R probably damaging Het
Gcn1l1 A G 5: 115,587,834 H553R probably benign Het
H2-Q6 C T 17: 35,425,566 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Med10 A G 13: 69,809,982 N18D probably damaging Het
Mgat4b T A 11: 50,233,338 H368Q possibly damaging Het
Morn5 C A 2: 36,053,023 T45N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Myrf T C 19: 10,218,151 T432A probably damaging Het
Nav3 T A 10: 109,694,035 E2148D probably damaging Het
Nfe2l3 A G 6: 51,456,615 T236A possibly damaging Het
Odc1 T A 12: 17,548,800 F227Y probably benign Het
Olfr1444 T C 19: 12,862,630 M285T possibly damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Pdcd1 T C 1: 94,041,264 I110V probably benign Het
Pde5a G A 3: 122,760,896 E212K probably damaging Het
Plin4 A G 17: 56,106,704 I307T probably benign Het
Rag1 T C 2: 101,643,039 Y586C probably damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rgs9 A G 11: 109,275,813 probably benign Het
Rin3 A G 12: 102,390,083 D961G probably damaging Het
Rubcn A G 16: 32,829,259 probably null Het
Slc13a2 T A 11: 78,398,400 Y495F probably damaging Het
Tfec T A 6: 16,845,459 D67V probably damaging Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Tmem94 T C 11: 115,789,254 M30T probably benign Het
Tubgcp6 A G 15: 89,104,414 probably benign Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r85 T C 10: 130,418,467 M783V probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Zfp94 T G 7: 24,303,687 D110A probably benign Het
Other mutations in Grin3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Grin3a APN 4 49770589 missense probably damaging 1.00
IGL01541:Grin3a APN 4 49792533 missense probably damaging 0.98
IGL01886:Grin3a APN 4 49702814 missense probably damaging 1.00
IGL02133:Grin3a APN 4 49792946 nonsense probably null
IGL02367:Grin3a APN 4 49702805 missense probably damaging 1.00
IGL02481:Grin3a APN 4 49702868 missense probably damaging 1.00
IGL02830:Grin3a APN 4 49702787 missense possibly damaging 0.94
IGL02945:Grin3a APN 4 49792971 missense possibly damaging 0.86
IGL03174:Grin3a APN 4 49771107 missense probably damaging 1.00
R0266:Grin3a UTSW 4 49665501 nonsense probably null
R0597:Grin3a UTSW 4 49665351 missense probably damaging 1.00
R0849:Grin3a UTSW 4 49665501 nonsense probably null
R1448:Grin3a UTSW 4 49702804 missense probably damaging 1.00
R1640:Grin3a UTSW 4 49844721 missense probably benign
R1751:Grin3a UTSW 4 49844423 missense probably damaging 1.00
R1767:Grin3a UTSW 4 49844423 missense probably damaging 1.00
R1858:Grin3a UTSW 4 49792437 missense probably benign 0.01
R1860:Grin3a UTSW 4 49665309 missense possibly damaging 0.95
R1924:Grin3a UTSW 4 49844988 missense possibly damaging 0.95
R2035:Grin3a UTSW 4 49771336 missense probably damaging 1.00
R2108:Grin3a UTSW 4 49665510 missense possibly damaging 0.91
R2307:Grin3a UTSW 4 49793033 critical splice acceptor site probably null
R3082:Grin3a UTSW 4 49665243 missense probably benign 0.00
R3083:Grin3a UTSW 4 49665243 missense probably benign 0.00
R3430:Grin3a UTSW 4 49792534 missense probably benign 0.01
R3695:Grin3a UTSW 4 49792704 missense possibly damaging 0.81
R4559:Grin3a UTSW 4 49844555 missense probably damaging 1.00
R4972:Grin3a UTSW 4 49770484 missense probably damaging 1.00
R4982:Grin3a UTSW 4 49665512 missense probably benign 0.03
R5385:Grin3a UTSW 4 49719313 missense probably damaging 1.00
R5423:Grin3a UTSW 4 49770376 intron probably benign
R5478:Grin3a UTSW 4 49792481 missense probably benign 0.00
R5634:Grin3a UTSW 4 49792843 missense probably damaging 1.00
R5790:Grin3a UTSW 4 49792717 missense probably damaging 1.00
R5976:Grin3a UTSW 4 49792602 missense probably damaging 1.00
R6271:Grin3a UTSW 4 49792516 missense probably benign 0.00
R6451:Grin3a UTSW 4 49844969 missense probably damaging 1.00
R6538:Grin3a UTSW 4 49770856 missense probably damaging 1.00
R6629:Grin3a UTSW 4 49844991 missense probably damaging 1.00
R7217:Grin3a UTSW 4 49770741 missense possibly damaging 0.81
R7337:Grin3a UTSW 4 49702762 missense probably damaging 1.00
R7338:Grin3a UTSW 4 49771238 missense probably benign
R7477:Grin3a UTSW 4 49719278 missense probably damaging 1.00
R8090:Grin3a UTSW 4 49714224 missense probably damaging 1.00
R8313:Grin3a UTSW 4 49665599 missense probably benign
Z1176:Grin3a UTSW 4 49770622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGAAGTATGCTATGAGTCC -3'
(R):5'- GGTCAGCTAGGACTACACAGTG -3'

Sequencing Primer
(F):5'- AAGTATGCTATGAGTCCTCTGTC -3'
(R):5'- AAGGCCTCTCCTGTCTTGCAG -3'
Posted On2015-04-17