Mutagenetix > Incidental Mutation

Incidental Mutation 'R0379:Col24a1'

30850

Institutional Source

Beutler Lab

Gene Symbol

Col24a1

Ensembl Gene

ENSMUSG00000028197

Gene Name

collagen, type XXIV, alpha 1

Synonyms

5430404K19Rik

MMRRC Submission

038585-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0379 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

145292472-145552011 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 145524142 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Lysine at position 1483 (R1483K)

Ref Sequence

ENSEMBL: ENSMUSP00000029848 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029848]

AlphaFold

Q30D77

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029848
AA Change: R1483K

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: R1483K

Domain	Start	End	E-Value	Type
transmembrane domain	21	40	N/A	INTRINSIC
TSPN	41	230	2.7e-3	SMART
LamG	106	229	8.07e-2	SMART
Pfam:Collagen	506	565	9.6e-10	PFAM
Pfam:Collagen	561	623	3.4e-10	PFAM
Pfam:Collagen	604	678	2.3e-9	PFAM
low complexity region	682	724	N/A	INTRINSIC
Pfam:Collagen	772	837	1.3e-10	PFAM
Pfam:Collagen	865	938	6e-9	PFAM
Pfam:Collagen	967	1042	3.1e-8	PFAM
low complexity region	1056	1075	N/A	INTRINSIC
Pfam:Collagen	1107	1180	8e-9	PFAM
Pfam:Collagen	1159	1218	4.2e-10	PFAM
Pfam:Collagen	1218	1279	1.8e-10	PFAM
Pfam:Collagen	1270	1334	3.1e-9	PFAM
Pfam:Collagen	1378	1443	1.3e-9	PFAM
Pfam:Collagen	1439	1500	1.8e-9	PFAM
COLFI	1533	1733	9.34e-34	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127379

Meta Mutation Damage Score

0.1504

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.7%
20x: 90.9%

Validation Efficiency

98% (79/81)

MGI Phenotype

FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	T	2: 130,785,546		probably benign	Het
4930512M02Rik	A	G	11: 11,589,365		probably benign	Het
Apba1	A	C	19: 23,934,830	N558T	probably damaging	Het
Arfgef2	T	A	2: 166,860,400		probably null	Het
Arsb	T	C	13: 93,940,627	S501P	probably benign	Het
Atp10b	A	G	11: 43,254,314	T1295A	probably benign	Het
Atp8b5	G	T	4: 43,361,898	R648L	probably damaging	Het
Bcl2a1b	T	C	9: 89,199,736	I126T	possibly damaging	Het
Brd9	T	C	13: 73,942,683		probably benign	Het
Cd93	T	C	2: 148,441,510		probably benign	Het
Chd5	A	G	4: 152,383,321	K1692R	probably benign	Het
Clcn4	T	C	7: 7,296,792	T13A	probably damaging	Het
Clec14a	A	G	12: 58,268,794	F14S	possibly damaging	Het
Clec4g	A	G	8: 3,718,440	V97A	probably benign	Het
Crem	A	T	18: 3,299,226	V82D	probably damaging	Het
Ctnna2	T	A	6: 77,641,440	T180S	probably benign	Het
Cybrd1	T	C	2: 71,129,755	I99T	probably benign	Het
Cyp4a32	G	A	4: 115,621,474	V468M	probably damaging	Het
Dlk1	A	G	12: 109,455,059		probably benign	Het
Dnah7b	A	T	1: 46,140,176	Y1003F	probably benign	Het
Egfem1	A	C	3: 29,668,250	E376A	possibly damaging	Het
Etl4	T	A	2: 20,807,354	I1416K	probably damaging	Het
Fbxl4	A	G	4: 22,386,106	T238A	probably benign	Het
Fer1l6	A	G	15: 58,548,338	I33M	probably benign	Het
Fndc3a	A	G	14: 72,556,609	S830P	probably damaging	Het
Fras1	C	T	5: 96,755,509	R3082*	probably null	Het
Galnt13	T	C	2: 55,060,492	V395A	possibly damaging	Het
Gm10334	T	G	6: 41,445,256		probably benign	Het
Gpd2	C	T	2: 57,345,263	T335I	probably damaging	Het
Gucy2d	C	A	7: 98,459,002		probably null	Het
Hydin	A	G	8: 110,509,127		probably benign	Het
Ints5	G	T	19: 8,897,133	V819L	possibly damaging	Het
Klhdc10	C	G	6: 30,450,670	Q292E	possibly damaging	Het
Lmbrd2	G	A	15: 9,149,479	A67T	probably benign	Het
Lrp1	T	G	10: 127,594,969	T404P	probably damaging	Het
March7	T	C	2: 60,234,126	S249P	probably benign	Het
Mcm10	T	A	2: 5,008,623	K66M	probably benign	Het
Mtmr7	C	A	8: 40,551,601	D645Y	probably damaging	Het
Muc6	T	A	7: 141,636,955	I2602F	possibly damaging	Het
Myh13	G	A	11: 67,369,295		probably benign	Het
Myo18a	G	A	11: 77,850,806	V1776I	possibly damaging	Het
Ncapg2	T	C	12: 116,443,075	L957S	probably damaging	Het
Ncoa3	T	C	2: 166,054,502	S442P	probably damaging	Het
Olfr1093	G	A	2: 86,785,735	E2K	probably benign	Het
Olfr850	T	A	9: 19,477,480	T257S	possibly damaging	Het
Olfr986	G	A	9: 40,187,433	G106D	probably damaging	Het
Pdcd6	G	T	13: 74,309,712	N113K	possibly damaging	Het
Pfkfb4	C	T	9: 109,027,742		probably benign	Het
Pfkm	A	G	15: 98,126,314	H401R	probably benign	Het
Phldb2	C	A	16: 45,781,451	D754Y	probably damaging	Het
Plekhb2	T	A	1: 34,863,114	M49K	probably damaging	Het
Polrmt	A	G	10: 79,737,611	S1057P	possibly damaging	Het
Prps1l1	A	G	12: 34,985,078	N64S	probably benign	Het
Psg16	T	C	7: 17,130,658	S393P	probably benign	Het
Rundc1	C	T	11: 101,425,147	T15I	probably benign	Het
Scaf11	A	G	15: 96,431,816	L143S	probably damaging	Het
Sephs1	A	G	2: 4,899,560	T250A	probably benign	Het
Serpinf1	T	G	11: 75,413,945	I197L	probably benign	Het
Siglec1	C	T	2: 131,074,525		probably benign	Het
Slc28a1	G	A	7: 81,138,177	V271I	probably benign	Het
Sntg1	T	C	1: 8,782,824	D34G	probably damaging	Het
Sptbn4	A	T	7: 27,359,736		probably benign	Het
Suclg1	T	C	6: 73,256,228	I51T	possibly damaging	Het
Syne1	C	T	10: 5,541,989	R9Q	probably damaging	Het
Trim47	T	A	11: 116,106,518	H470L	probably damaging	Het
Ttc41	T	A	10: 86,712,977	Y12N	possibly damaging	Het
Tubgcp2	T	C	7: 140,032,192	E69G	probably damaging	Het
Tubgcp3	G	A	8: 12,641,116	T474M	probably damaging	Het
Ubr5	A	T	15: 38,018,957	N777K	probably benign	Het
Ush2a	T	C	1: 188,451,819	L1440P	probably damaging	Het
Usp28	A	C	9: 49,024,067	D458A	possibly damaging	Het
Vcan	A	T	13: 89,703,546	D1098E	probably damaging	Het
Vmn1r73	C	T	7: 11,756,846	T197I	probably benign	Het
Vmn2r15	T	C	5: 109,286,478	S787G	probably damaging	Het
Vmn2r90	T	A	17: 17,728,139	I549N	probably damaging	Het
Vps33b	T	A	7: 80,283,414		probably null	Het
Zfp516	A	T	18: 82,987,670	K900*	probably null	Het
Zfp974	T	A	7: 27,910,932	N456I	probably damaging	Het

Other mutations in Col24a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Col24a1	APN	3	145362309	missense	probably damaging	1.00
IGL00931:Col24a1	APN	3	145461470	missense	probably benign	0.00
IGL01160:Col24a1	APN	3	145507713	missense	probably damaging	1.00
IGL01355:Col24a1	APN	3	145314876	missense	probably benign	0.07
IGL01409:Col24a1	APN	3	145538564	missense	probably benign	0.19
IGL01587:Col24a1	APN	3	145433355	splice site	probably null
IGL01666:Col24a1	APN	3	145344686	missense	possibly damaging	0.93
IGL01717:Col24a1	APN	3	145524263	splice site	probably benign
IGL01721:Col24a1	APN	3	145538567	missense	probably benign	0.26
IGL01939:Col24a1	APN	3	145315244	missense	probably damaging	1.00
IGL01988:Col24a1	APN	3	145524167	splice site	probably null
IGL02002:Col24a1	APN	3	145356944	missense	possibly damaging	0.81
IGL02172:Col24a1	APN	3	145314962	missense	probably benign	0.34
IGL02552:Col24a1	APN	3	145474207	missense	possibly damaging	0.88
IGL02559:Col24a1	APN	3	145314173	missense	probably benign
IGL02582:Col24a1	APN	3	145314486	missense	probably damaging	1.00
IGL02652:Col24a1	APN	3	145492301	nonsense	probably null
IGL02942:Col24a1	APN	3	145541665	missense	probably damaging	1.00
IGL03032:Col24a1	APN	3	145538703	critical splice donor site	probably null
IGL03108:Col24a1	APN	3	145323401	missense	probably damaging	1.00
IGL03310:Col24a1	APN	3	145313983	splice site	probably benign
IGL03405:Col24a1	APN	3	145315157	missense	possibly damaging	0.73
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0502:Col24a1	UTSW	3	145545316	splice site	probably benign
R0556:Col24a1	UTSW	3	145314728	missense	possibly damaging	0.53
R0587:Col24a1	UTSW	3	145293145	missense	possibly damaging	0.50
R0617:Col24a1	UTSW	3	145314120	missense	probably damaging	1.00
R0831:Col24a1	UTSW	3	145328759	missense	probably damaging	1.00
R1455:Col24a1	UTSW	3	145460838	missense	probably damaging	1.00
R1664:Col24a1	UTSW	3	145389600	critical splice donor site	probably null
R1713:Col24a1	UTSW	3	145366869	nonsense	probably null
R1854:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1855:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1861:Col24a1	UTSW	3	145537267	critical splice donor site	probably null
R1969:Col24a1	UTSW	3	145314930	missense	probably benign	0.03
R2216:Col24a1	UTSW	3	145314981	missense	probably benign	0.34
R2290:Col24a1	UTSW	3	145513195	missense	probably damaging	1.00
R3702:Col24a1	UTSW	3	145337860	missense	probably benign	0.01
R3772:Col24a1	UTSW	3	145545286	missense	probably damaging	1.00
R4086:Col24a1	UTSW	3	145461437	missense	probably damaging	1.00
R4236:Col24a1	UTSW	3	145524282	nonsense	probably null
R4433:Col24a1	UTSW	3	145314383	missense	possibly damaging	0.95
R4688:Col24a1	UTSW	3	145314383	missense	probably benign	0.00
R4972:Col24a1	UTSW	3	145509684	missense	probably benign	0.42
R5157:Col24a1	UTSW	3	145345951	nonsense	probably null
R5216:Col24a1	UTSW	3	145315310	missense	possibly damaging	0.85
R5274:Col24a1	UTSW	3	145484678	missense	probably benign	0.03
R5334:Col24a1	UTSW	3	145461525	missense	possibly damaging	0.91
R5416:Col24a1	UTSW	3	145315025	nonsense	probably null
R5473:Col24a1	UTSW	3	145537261	missense	probably benign	0.41
R5538:Col24a1	UTSW	3	145293121	missense	probably damaging	0.99
R5561:Col24a1	UTSW	3	145298827	missense	probably benign	0.26
R5648:Col24a1	UTSW	3	145358566	missense	probably benign	0.00
R5920:Col24a1	UTSW	3	145428230	missense	probably damaging	1.00
R6111:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6151:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6701:Col24a1	UTSW	3	145314380	missense	probably benign	0.00
R6728:Col24a1	UTSW	3	145315196	missense	probably benign
R6734:Col24a1	UTSW	3	145508674	missense	probably benign	0.06
R6861:Col24a1	UTSW	3	145460834	missense	probably damaging	1.00
R6982:Col24a1	UTSW	3	145315046	nonsense	probably null
R7001:Col24a1	UTSW	3	145298866	missense	probably benign	0.28
R7148:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R7293:Col24a1	UTSW	3	145486304	nonsense	probably null
R7315:Col24a1	UTSW	3	145431870	missense	possibly damaging	0.82
R7358:Col24a1	UTSW	3	145293165	critical splice donor site	probably null
R7371:Col24a1	UTSW	3	145343698	missense	probably benign	0.06
R7383:Col24a1	UTSW	3	145298838	missense	probably benign
R7605:Col24a1	UTSW	3	145538687	missense	possibly damaging	0.67
R7650:Col24a1	UTSW	3	145314453	missense	probably benign	0.00
R7679:Col24a1	UTSW	3	145399355	missense	possibly damaging	0.81
R7701:Col24a1	UTSW	3	145315011	missense	probably benign
R7701:Col24a1	UTSW	3	145366901	splice site	probably null
R7805:Col24a1	UTSW	3	145314140	missense	probably benign	0.02
R7913:Col24a1	UTSW	3	145431866	nonsense	probably null
R7921:Col24a1	UTSW	3	145474238	missense	probably damaging	1.00
R8056:Col24a1	UTSW	3	145314164	missense	possibly damaging	0.73
R8240:Col24a1	UTSW	3	145507702	missense	probably benign	0.31
R8294:Col24a1	UTSW	3	145481089	missense	probably null	1.00
R8305:Col24a1	UTSW	3	145474182	missense	probably benign	0.00
R8430:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R8708:Col24a1	UTSW	3	145545265	missense	probably damaging	0.99
R8880:Col24a1	UTSW	3	145314037	missense	probably null
R9056:Col24a1	UTSW	3	145315248	missense	probably damaging	0.96
R9461:Col24a1	UTSW	3	145481124	nonsense	probably null
R9612:Col24a1	UTSW	3	145545205	missense	probably benign	0.32
R9777:Col24a1	UTSW	3	145315342	nonsense	probably null
Z1176:Col24a1	UTSW	3	145342498	missense	probably damaging	1.00
Z1177:Col24a1	UTSW	3	145342499	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAATGAGGGTCCCAGCTTTGGTG -3'
(R):5'- ACTTACTCTTGGACCAGGTGCTCC -3'

Sequencing Primer
(F):5'- AACTTCCAGGTTGTTCAGAATTGTG -3'
(R):5'- AGGTGCTCCAGGTGGAC -3'

Posted On

2013-04-24