Incidental Mutation 'R0379:Col24a1'
ID 30850
Institutional Source Beutler Lab
Gene Symbol Col24a1
Ensembl Gene ENSMUSG00000028197
Gene Name collagen, type XXIV, alpha 1
Synonyms 5430404K19Rik
MMRRC Submission 038585-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0379 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 144998233-145257766 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 145229897 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Lysine at position 1483 (R1483K)
Ref Sequence ENSEMBL: ENSMUSP00000029848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029848]
AlphaFold Q30D77
Predicted Effect possibly damaging
Transcript: ENSMUST00000029848
AA Change: R1483K

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: R1483K

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
TSPN 41 230 2.7e-3 SMART
LamG 106 229 8.07e-2 SMART
Pfam:Collagen 506 565 9.6e-10 PFAM
Pfam:Collagen 561 623 3.4e-10 PFAM
Pfam:Collagen 604 678 2.3e-9 PFAM
low complexity region 682 724 N/A INTRINSIC
Pfam:Collagen 772 837 1.3e-10 PFAM
Pfam:Collagen 865 938 6e-9 PFAM
Pfam:Collagen 967 1042 3.1e-8 PFAM
low complexity region 1056 1075 N/A INTRINSIC
Pfam:Collagen 1107 1180 8e-9 PFAM
Pfam:Collagen 1159 1218 4.2e-10 PFAM
Pfam:Collagen 1218 1279 1.8e-10 PFAM
Pfam:Collagen 1270 1334 3.1e-9 PFAM
Pfam:Collagen 1378 1443 1.3e-9 PFAM
Pfam:Collagen 1439 1500 1.8e-9 PFAM
COLFI 1533 1733 9.34e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127379
Meta Mutation Damage Score 0.1504 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930512M02Rik A G 11: 11,539,365 (GRCm39) probably benign Het
Apba1 A C 19: 23,912,194 (GRCm39) N558T probably damaging Het
Arfgef2 T A 2: 166,702,320 (GRCm39) probably null Het
Arsb T C 13: 94,077,135 (GRCm39) S501P probably benign Het
Atp10b A G 11: 43,145,141 (GRCm39) T1295A probably benign Het
Atp8b5 G T 4: 43,361,898 (GRCm39) R648L probably damaging Het
Bcl2a1b T C 9: 89,081,789 (GRCm39) I126T possibly damaging Het
Brd9 T C 13: 74,090,802 (GRCm39) probably benign Het
Cd93 T C 2: 148,283,430 (GRCm39) probably benign Het
Chd5 A G 4: 152,467,778 (GRCm39) K1692R probably benign Het
Clcn4 T C 7: 7,299,791 (GRCm39) T13A probably damaging Het
Clec14a A G 12: 58,315,580 (GRCm39) F14S possibly damaging Het
Clec4g A G 8: 3,768,440 (GRCm39) V97A probably benign Het
Crem A T 18: 3,299,226 (GRCm39) V82D probably damaging Het
Ctnna2 T A 6: 77,618,423 (GRCm39) T180S probably benign Het
Cybrd1 T C 2: 70,960,099 (GRCm39) I99T probably benign Het
Cyp4a32 G A 4: 115,478,671 (GRCm39) V468M probably damaging Het
Dlk1 A G 12: 109,420,985 (GRCm39) probably benign Het
Dnaaf9 C T 2: 130,627,466 (GRCm39) probably benign Het
Dnah7b A T 1: 46,179,336 (GRCm39) Y1003F probably benign Het
Egfem1 A C 3: 29,722,399 (GRCm39) E376A possibly damaging Het
Etl4 T A 2: 20,812,165 (GRCm39) I1416K probably damaging Het
Fbxl4 A G 4: 22,386,106 (GRCm39) T238A probably benign Het
Fer1l6 A G 15: 58,420,187 (GRCm39) I33M probably benign Het
Fndc3a A G 14: 72,794,049 (GRCm39) S830P probably damaging Het
Fras1 C T 5: 96,903,368 (GRCm39) R3082* probably null Het
Galnt13 T C 2: 54,950,504 (GRCm39) V395A possibly damaging Het
Gpd2 C T 2: 57,235,275 (GRCm39) T335I probably damaging Het
Gucy2d C A 7: 98,108,209 (GRCm39) probably null Het
Hydin A G 8: 111,235,759 (GRCm39) probably benign Het
Ints5 G T 19: 8,874,497 (GRCm39) V819L possibly damaging Het
Klhdc10 C G 6: 30,450,669 (GRCm39) Q292E possibly damaging Het
Lmbrd2 G A 15: 9,149,566 (GRCm39) A67T probably benign Het
Lrp1 T G 10: 127,430,838 (GRCm39) T404P probably damaging Het
Marchf7 T C 2: 60,064,470 (GRCm39) S249P probably benign Het
Mcm10 T A 2: 5,013,434 (GRCm39) K66M probably benign Het
Mtmr7 C A 8: 41,004,642 (GRCm39) D645Y probably damaging Het
Muc6 T A 7: 141,216,868 (GRCm39) I2602F possibly damaging Het
Myh13 G A 11: 67,260,121 (GRCm39) probably benign Het
Myo18a G A 11: 77,741,632 (GRCm39) V1776I possibly damaging Het
Ncapg2 T C 12: 116,406,695 (GRCm39) L957S probably damaging Het
Ncoa3 T C 2: 165,896,422 (GRCm39) S442P probably damaging Het
Or5t5 G A 2: 86,616,079 (GRCm39) E2K probably benign Het
Or6x1 G A 9: 40,098,729 (GRCm39) G106D probably damaging Het
Or7g32 T A 9: 19,388,776 (GRCm39) T257S possibly damaging Het
Pdcd6 G T 13: 74,457,831 (GRCm39) N113K possibly damaging Het
Pfkfb4 C T 9: 108,856,810 (GRCm39) probably benign Het
Pfkm A G 15: 98,024,195 (GRCm39) H401R probably benign Het
Phldb2 C A 16: 45,601,814 (GRCm39) D754Y probably damaging Het
Plekhb2 T A 1: 34,902,195 (GRCm39) M49K probably damaging Het
Polrmt A G 10: 79,573,445 (GRCm39) S1057P possibly damaging Het
Prps1l1 A G 12: 35,035,077 (GRCm39) N64S probably benign Het
Prss3l T G 6: 41,422,190 (GRCm39) probably benign Het
Psg16 T C 7: 16,864,583 (GRCm39) S393P probably benign Het
Rundc1 C T 11: 101,315,973 (GRCm39) T15I probably benign Het
Scaf11 A G 15: 96,329,697 (GRCm39) L143S probably damaging Het
Sephs1 A G 2: 4,904,371 (GRCm39) T250A probably benign Het
Serpinf1 T G 11: 75,304,771 (GRCm39) I197L probably benign Het
Siglec1 C T 2: 130,916,445 (GRCm39) probably benign Het
Slc28a1 G A 7: 80,787,925 (GRCm39) V271I probably benign Het
Sntg1 T C 1: 8,853,048 (GRCm39) D34G probably damaging Het
Sptbn4 A T 7: 27,059,161 (GRCm39) probably benign Het
Suclg1 T C 6: 73,233,211 (GRCm39) I51T possibly damaging Het
Syne1 C T 10: 5,491,989 (GRCm39) R9Q probably damaging Het
Trim47 T A 11: 115,997,344 (GRCm39) H470L probably damaging Het
Ttc41 T A 10: 86,548,841 (GRCm39) Y12N possibly damaging Het
Tubgcp2 T C 7: 139,612,105 (GRCm39) E69G probably damaging Het
Tubgcp3 G A 8: 12,691,116 (GRCm39) T474M probably damaging Het
Ubr5 A T 15: 38,019,201 (GRCm39) N777K probably benign Het
Ush2a T C 1: 188,184,016 (GRCm39) L1440P probably damaging Het
Usp28 A C 9: 48,935,367 (GRCm39) D458A possibly damaging Het
Vcan A T 13: 89,851,665 (GRCm39) D1098E probably damaging Het
Vmn1r73 C T 7: 11,490,773 (GRCm39) T197I probably benign Het
Vmn2r15 T C 5: 109,434,344 (GRCm39) S787G probably damaging Het
Vmn2r90 T A 17: 17,948,401 (GRCm39) I549N probably damaging Het
Vps33b T A 7: 79,933,162 (GRCm39) probably null Het
Zfp516 A T 18: 83,005,795 (GRCm39) K900* probably null Het
Zfp974 T A 7: 27,610,357 (GRCm39) N456I probably damaging Het
Other mutations in Col24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Col24a1 APN 3 145,068,064 (GRCm39) missense probably damaging 1.00
IGL00931:Col24a1 APN 3 145,167,225 (GRCm39) missense probably benign 0.00
IGL01160:Col24a1 APN 3 145,213,468 (GRCm39) missense probably damaging 1.00
IGL01355:Col24a1 APN 3 145,020,637 (GRCm39) missense probably benign 0.07
IGL01409:Col24a1 APN 3 145,244,319 (GRCm39) missense probably benign 0.19
IGL01587:Col24a1 APN 3 145,139,110 (GRCm39) splice site probably null
IGL01666:Col24a1 APN 3 145,050,447 (GRCm39) missense possibly damaging 0.93
IGL01717:Col24a1 APN 3 145,230,018 (GRCm39) splice site probably benign
IGL01721:Col24a1 APN 3 145,244,322 (GRCm39) missense probably benign 0.26
IGL01939:Col24a1 APN 3 145,021,005 (GRCm39) missense probably damaging 1.00
IGL01988:Col24a1 APN 3 145,229,922 (GRCm39) splice site probably null
IGL02002:Col24a1 APN 3 145,062,699 (GRCm39) missense possibly damaging 0.81
IGL02172:Col24a1 APN 3 145,020,723 (GRCm39) missense probably benign 0.34
IGL02552:Col24a1 APN 3 145,179,962 (GRCm39) missense possibly damaging 0.88
IGL02559:Col24a1 APN 3 145,019,934 (GRCm39) missense probably benign
IGL02582:Col24a1 APN 3 145,020,247 (GRCm39) missense probably damaging 1.00
IGL02652:Col24a1 APN 3 145,198,056 (GRCm39) nonsense probably null
IGL02942:Col24a1 APN 3 145,247,420 (GRCm39) missense probably damaging 1.00
IGL03032:Col24a1 APN 3 145,244,458 (GRCm39) critical splice donor site probably null
IGL03108:Col24a1 APN 3 145,029,162 (GRCm39) missense probably damaging 1.00
IGL03310:Col24a1 APN 3 145,019,744 (GRCm39) splice site probably benign
IGL03405:Col24a1 APN 3 145,020,918 (GRCm39) missense possibly damaging 0.73
R0066:Col24a1 UTSW 3 145,250,899 (GRCm39) missense probably damaging 1.00
R0066:Col24a1 UTSW 3 145,250,899 (GRCm39) missense probably damaging 1.00
R0502:Col24a1 UTSW 3 145,251,071 (GRCm39) splice site probably benign
R0556:Col24a1 UTSW 3 145,020,489 (GRCm39) missense possibly damaging 0.53
R0587:Col24a1 UTSW 3 144,998,906 (GRCm39) missense possibly damaging 0.50
R0617:Col24a1 UTSW 3 145,019,881 (GRCm39) missense probably damaging 1.00
R0831:Col24a1 UTSW 3 145,034,520 (GRCm39) missense probably damaging 1.00
R1455:Col24a1 UTSW 3 145,166,593 (GRCm39) missense probably damaging 1.00
R1664:Col24a1 UTSW 3 145,095,355 (GRCm39) critical splice donor site probably null
R1713:Col24a1 UTSW 3 145,072,624 (GRCm39) nonsense probably null
R1854:Col24a1 UTSW 3 145,164,895 (GRCm39) missense probably damaging 1.00
R1855:Col24a1 UTSW 3 145,164,895 (GRCm39) missense probably damaging 1.00
R1861:Col24a1 UTSW 3 145,243,022 (GRCm39) critical splice donor site probably null
R1969:Col24a1 UTSW 3 145,020,691 (GRCm39) missense probably benign 0.03
R2216:Col24a1 UTSW 3 145,020,742 (GRCm39) missense probably benign 0.34
R2290:Col24a1 UTSW 3 145,218,950 (GRCm39) missense probably damaging 1.00
R3702:Col24a1 UTSW 3 145,043,621 (GRCm39) missense probably benign 0.01
R3772:Col24a1 UTSW 3 145,251,041 (GRCm39) missense probably damaging 1.00
R4086:Col24a1 UTSW 3 145,167,192 (GRCm39) missense probably damaging 1.00
R4236:Col24a1 UTSW 3 145,230,037 (GRCm39) nonsense probably null
R4433:Col24a1 UTSW 3 145,020,144 (GRCm39) missense possibly damaging 0.95
R4688:Col24a1 UTSW 3 145,020,144 (GRCm39) missense probably benign 0.00
R4972:Col24a1 UTSW 3 145,215,439 (GRCm39) missense probably benign 0.42
R5157:Col24a1 UTSW 3 145,051,712 (GRCm39) nonsense probably null
R5216:Col24a1 UTSW 3 145,021,071 (GRCm39) missense possibly damaging 0.85
R5274:Col24a1 UTSW 3 145,190,433 (GRCm39) missense probably benign 0.03
R5334:Col24a1 UTSW 3 145,167,280 (GRCm39) missense possibly damaging 0.91
R5416:Col24a1 UTSW 3 145,020,786 (GRCm39) nonsense probably null
R5473:Col24a1 UTSW 3 145,243,016 (GRCm39) missense probably benign 0.41
R5538:Col24a1 UTSW 3 144,998,882 (GRCm39) missense probably damaging 0.99
R5561:Col24a1 UTSW 3 145,004,588 (GRCm39) missense probably benign 0.26
R5648:Col24a1 UTSW 3 145,064,321 (GRCm39) missense probably benign 0.00
R5920:Col24a1 UTSW 3 145,133,985 (GRCm39) missense probably damaging 1.00
R6111:Col24a1 UTSW 3 145,019,815 (GRCm39) missense probably damaging 0.99
R6151:Col24a1 UTSW 3 145,019,815 (GRCm39) missense probably damaging 0.99
R6701:Col24a1 UTSW 3 145,020,141 (GRCm39) missense probably benign 0.00
R6728:Col24a1 UTSW 3 145,020,957 (GRCm39) missense probably benign
R6734:Col24a1 UTSW 3 145,214,429 (GRCm39) missense probably benign 0.06
R6861:Col24a1 UTSW 3 145,166,589 (GRCm39) missense probably damaging 1.00
R6982:Col24a1 UTSW 3 145,020,807 (GRCm39) nonsense probably null
R7001:Col24a1 UTSW 3 145,004,627 (GRCm39) missense probably benign 0.28
R7148:Col24a1 UTSW 3 145,021,060 (GRCm39) missense probably damaging 1.00
R7293:Col24a1 UTSW 3 145,192,059 (GRCm39) nonsense probably null
R7315:Col24a1 UTSW 3 145,137,625 (GRCm39) missense possibly damaging 0.82
R7358:Col24a1 UTSW 3 144,998,926 (GRCm39) critical splice donor site probably null
R7371:Col24a1 UTSW 3 145,049,459 (GRCm39) missense probably benign 0.06
R7383:Col24a1 UTSW 3 145,004,599 (GRCm39) missense probably benign
R7605:Col24a1 UTSW 3 145,244,442 (GRCm39) missense possibly damaging 0.67
R7650:Col24a1 UTSW 3 145,020,214 (GRCm39) missense probably benign 0.00
R7679:Col24a1 UTSW 3 145,105,110 (GRCm39) missense possibly damaging 0.81
R7701:Col24a1 UTSW 3 145,072,656 (GRCm39) splice site probably null
R7701:Col24a1 UTSW 3 145,020,772 (GRCm39) missense probably benign
R7805:Col24a1 UTSW 3 145,019,901 (GRCm39) missense probably benign 0.02
R7913:Col24a1 UTSW 3 145,137,621 (GRCm39) nonsense probably null
R7921:Col24a1 UTSW 3 145,179,993 (GRCm39) missense probably damaging 1.00
R8056:Col24a1 UTSW 3 145,019,925 (GRCm39) missense possibly damaging 0.73
R8240:Col24a1 UTSW 3 145,213,457 (GRCm39) missense probably benign 0.31
R8294:Col24a1 UTSW 3 145,186,844 (GRCm39) missense probably null 1.00
R8305:Col24a1 UTSW 3 145,179,937 (GRCm39) missense probably benign 0.00
R8430:Col24a1 UTSW 3 145,021,060 (GRCm39) missense probably damaging 1.00
R8708:Col24a1 UTSW 3 145,251,020 (GRCm39) missense probably damaging 0.99
R8880:Col24a1 UTSW 3 145,019,798 (GRCm39) missense probably null
R9056:Col24a1 UTSW 3 145,021,009 (GRCm39) missense probably damaging 0.96
R9461:Col24a1 UTSW 3 145,186,879 (GRCm39) nonsense probably null
R9612:Col24a1 UTSW 3 145,250,960 (GRCm39) missense probably benign 0.32
R9777:Col24a1 UTSW 3 145,021,103 (GRCm39) nonsense probably null
Z1176:Col24a1 UTSW 3 145,048,259 (GRCm39) missense probably damaging 1.00
Z1177:Col24a1 UTSW 3 145,048,260 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAATGAGGGTCCCAGCTTTGGTG -3'
(R):5'- ACTTACTCTTGGACCAGGTGCTCC -3'

Sequencing Primer
(F):5'- AACTTCCAGGTTGTTCAGAATTGTG -3'
(R):5'- AGGTGCTCCAGGTGGAC -3'
Posted On 2013-04-24