Incidental Mutation 'R3932:Zfp94'
ID308500
Institutional Source Beutler Lab
Gene Symbol Zfp94
Ensembl Gene ENSMUSG00000074282
Gene Namezinc finger protein 94
Synonyms
MMRRC Submission 040919-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R3932 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location24301704-24316666 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 24303687 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 110 (D110A)
Ref Sequence ENSEMBL: ENSMUSP00000104075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032673] [ENSMUST00000077780] [ENSMUST00000108436] [ENSMUST00000145131]
Predicted Effect probably benign
Transcript: ENSMUST00000032673
AA Change: D104A

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000032673
Gene: ENSMUSG00000074282
AA Change: D104A

DomainStartEndE-ValueType
KRAB 2 59 3.06e-19 SMART
ZnF_C2H2 157 179 5.06e-2 SMART
ZnF_C2H2 185 207 8.47e-4 SMART
ZnF_C2H2 213 235 4.72e-2 SMART
ZnF_C2H2 241 263 1.28e-3 SMART
ZnF_C2H2 269 291 5.21e-4 SMART
ZnF_C2H2 297 319 9.08e-4 SMART
ZnF_C2H2 325 347 2.09e-3 SMART
ZnF_C2H2 353 375 8.94e-3 SMART
ZnF_C2H2 381 403 2.4e-3 SMART
ZnF_C2H2 409 431 8.6e-5 SMART
ZnF_C2H2 437 459 7.9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077780
SMART Domains Protein: ENSMUSP00000076954
Gene: ENSMUSG00000050605

DomainStartEndE-ValueType
KRAB 4 63 2.28e-27 SMART
ZnF_C2H2 311 333 1.4e-4 SMART
ZnF_C2H2 339 361 5.5e-3 SMART
ZnF_C2H2 367 389 2.99e-4 SMART
ZnF_C2H2 395 417 1.18e-2 SMART
ZnF_C2H2 423 445 2.4e-3 SMART
ZnF_C2H2 451 473 2.95e-3 SMART
ZnF_C2H2 479 501 9.88e-5 SMART
ZnF_C2H2 507 529 1.5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108436
AA Change: D110A

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000104075
Gene: ENSMUSG00000074282
AA Change: D110A

DomainStartEndE-ValueType
KRAB 8 65 3.06e-19 SMART
ZnF_C2H2 163 185 5.06e-2 SMART
ZnF_C2H2 191 213 8.47e-4 SMART
ZnF_C2H2 219 241 4.72e-2 SMART
ZnF_C2H2 247 269 1.28e-3 SMART
ZnF_C2H2 275 297 5.21e-4 SMART
ZnF_C2H2 303 325 9.08e-4 SMART
ZnF_C2H2 331 353 2.09e-3 SMART
ZnF_C2H2 359 381 8.94e-3 SMART
ZnF_C2H2 387 409 2.4e-3 SMART
ZnF_C2H2 415 437 8.6e-5 SMART
ZnF_C2H2 443 465 7.9e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139811
Predicted Effect probably benign
Transcript: ENSMUST00000145131
SMART Domains Protein: ENSMUSP00000117077
Gene: ENSMUSG00000050605

DomainStartEndE-ValueType
KRAB 4 64 4.63e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206535
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b2 C T 7: 81,473,850 probably benign Het
Arl1 C T 10: 88,733,536 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp10a T C 7: 58,827,104 M1189T possibly damaging Het
BC051142 A G 17: 34,443,443 T86A possibly damaging Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
Cdc34b G A 11: 94,742,615 V214M probably benign Het
Cfap54 T C 10: 92,829,757 T2985A probably benign Het
Clcc1 T C 3: 108,673,366 M332T probably damaging Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ctdnep1 A G 11: 69,989,574 probably benign Het
Edar C T 10: 58,610,342 C221Y probably damaging Het
Fam135b T A 15: 71,450,431 Q1295L probably benign Het
Fam184a C T 10: 53,699,301 A71T probably damaging Het
Fbxw10 A G 11: 62,869,157 probably benign Het
Frmd4a T C 2: 4,537,260 W247R probably damaging Het
Gcn1l1 A G 5: 115,587,834 H553R probably benign Het
Grin3a C T 4: 49,672,472 probably null Het
H2-Q6 C T 17: 35,425,566 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Med10 A G 13: 69,809,982 N18D probably damaging Het
Mgat4b T A 11: 50,233,338 H368Q possibly damaging Het
Morn5 C A 2: 36,053,023 T45N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Myrf T C 19: 10,218,151 T432A probably damaging Het
Nav3 T A 10: 109,694,035 E2148D probably damaging Het
Nfe2l3 A G 6: 51,456,615 T236A possibly damaging Het
Odc1 T A 12: 17,548,800 F227Y probably benign Het
Olfr1444 T C 19: 12,862,630 M285T possibly damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Pdcd1 T C 1: 94,041,264 I110V probably benign Het
Pde5a G A 3: 122,760,896 E212K probably damaging Het
Plin4 A G 17: 56,106,704 I307T probably benign Het
Rag1 T C 2: 101,643,039 Y586C probably damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rgs9 A G 11: 109,275,813 probably benign Het
Rin3 A G 12: 102,390,083 D961G probably damaging Het
Rubcn A G 16: 32,829,259 probably null Het
Slc13a2 T A 11: 78,398,400 Y495F probably damaging Het
Tfec T A 6: 16,845,459 D67V probably damaging Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Tmem94 T C 11: 115,789,254 M30T probably benign Het
Tubgcp6 A G 15: 89,104,414 probably benign Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r85 T C 10: 130,418,467 M783V probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Other mutations in Zfp94
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01755:Zfp94 APN 7 24311481 utr 5 prime probably benign
IGL02645:Zfp94 APN 7 24303754 missense probably benign
R0684:Zfp94 UTSW 7 24303070 missense probably damaging 1.00
R1177:Zfp94 UTSW 7 24303528 missense probably damaging 1.00
R1644:Zfp94 UTSW 7 24311502 splice site probably benign
R1675:Zfp94 UTSW 7 24302834 missense probably damaging 1.00
R1826:Zfp94 UTSW 7 24309115 missense probably damaging 1.00
R1861:Zfp94 UTSW 7 24309116 missense probably damaging 1.00
R4912:Zfp94 UTSW 7 24303741 missense probably benign 0.05
R5663:Zfp94 UTSW 7 24302827 missense probably damaging 1.00
R6539:Zfp94 UTSW 7 24303291 missense probably damaging 1.00
R7023:Zfp94 UTSW 7 24303396 missense probably damaging 1.00
R7710:Zfp94 UTSW 7 24303682 missense probably benign
R7810:Zfp94 UTSW 7 24303073 missense probably benign 0.00
R8134:Zfp94 UTSW 7 24303741 missense probably benign 0.40
R8291:Zfp94 UTSW 7 24302730 missense probably damaging 1.00
Z1176:Zfp94 UTSW 7 24303811 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGGAGACCCGATAACCGAC -3'
(R):5'- TTCTAGGAGACAAGAATCCTGAGG -3'

Sequencing Primer
(F):5'- AGAAGGCGTGGTCACATTTTTCAC -3'
(R):5'- CAAGAATCCTGAGGAGATGGAGTC -3'
Posted On2015-04-17