Incidental Mutation 'R3932:Ap3b2'
ID308502
Institutional Source Beutler Lab
Gene Symbol Ap3b2
Ensembl Gene ENSMUSG00000062444
Gene Nameadaptor-related protein complex 3, beta 2 subunit
Synonymsbeta3B, Naptb
MMRRC Submission 040919-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R3932 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location81460399-81493925 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 81473850 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]
Predicted Effect probably benign
Transcript: ENSMUST00000082090
SMART Domains Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 590 8.2e-182 PFAM
low complexity region 689 782 N/A INTRINSIC
AP3B1_C 801 947 4.58e-75 SMART
Blast:B2 971 1080 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125634
Predicted Effect probably benign
Transcript: ENSMUST00000152355
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl1 C T 10: 88,733,536 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp10a T C 7: 58,827,104 M1189T possibly damaging Het
BC051142 A G 17: 34,443,443 T86A possibly damaging Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
Cdc34b G A 11: 94,742,615 V214M probably benign Het
Cfap54 T C 10: 92,829,757 T2985A probably benign Het
Clcc1 T C 3: 108,673,366 M332T probably damaging Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ctdnep1 A G 11: 69,989,574 probably benign Het
Edar C T 10: 58,610,342 C221Y probably damaging Het
Fam135b T A 15: 71,450,431 Q1295L probably benign Het
Fam184a C T 10: 53,699,301 A71T probably damaging Het
Fbxw10 A G 11: 62,869,157 probably benign Het
Frmd4a T C 2: 4,537,260 W247R probably damaging Het
Gcn1l1 A G 5: 115,587,834 H553R probably benign Het
Grin3a C T 4: 49,672,472 probably null Het
H2-Q6 C T 17: 35,425,566 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Med10 A G 13: 69,809,982 N18D probably damaging Het
Mgat4b T A 11: 50,233,338 H368Q possibly damaging Het
Morn5 C A 2: 36,053,023 T45N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Myrf T C 19: 10,218,151 T432A probably damaging Het
Nav3 T A 10: 109,694,035 E2148D probably damaging Het
Nfe2l3 A G 6: 51,456,615 T236A possibly damaging Het
Odc1 T A 12: 17,548,800 F227Y probably benign Het
Olfr1444 T C 19: 12,862,630 M285T possibly damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Pdcd1 T C 1: 94,041,264 I110V probably benign Het
Pde5a G A 3: 122,760,896 E212K probably damaging Het
Plin4 A G 17: 56,106,704 I307T probably benign Het
Rag1 T C 2: 101,643,039 Y586C probably damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rgs9 A G 11: 109,275,813 probably benign Het
Rin3 A G 12: 102,390,083 D961G probably damaging Het
Rubcn A G 16: 32,829,259 probably null Het
Slc13a2 T A 11: 78,398,400 Y495F probably damaging Het
Tfec T A 6: 16,845,459 D67V probably damaging Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Tmem94 T C 11: 115,789,254 M30T probably benign Het
Tubgcp6 A G 15: 89,104,414 probably benign Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r85 T C 10: 130,418,467 M783V probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Zfp94 T G 7: 24,303,687 D110A probably benign Het
Other mutations in Ap3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Ap3b2 APN 7 81471949 missense probably damaging 0.98
IGL01695:Ap3b2 APN 7 81476939 splice site probably benign
IGL01876:Ap3b2 APN 7 81473854 splice site probably null
IGL02132:Ap3b2 APN 7 81460998 missense unknown
IGL02227:Ap3b2 APN 7 81473404 missense probably damaging 1.00
IGL02660:Ap3b2 APN 7 81465698 missense probably benign 0.13
R0045:Ap3b2 UTSW 7 81466193 missense possibly damaging 0.82
R0045:Ap3b2 UTSW 7 81466193 missense possibly damaging 0.82
R0142:Ap3b2 UTSW 7 81473080 missense probably damaging 0.96
R0317:Ap3b2 UTSW 7 81463681 splice site probably null
R0568:Ap3b2 UTSW 7 81464629 critical splice donor site probably null
R1035:Ap3b2 UTSW 7 81463911 missense unknown
R1121:Ap3b2 UTSW 7 81464195 missense unknown
R1160:Ap3b2 UTSW 7 81466169 critical splice donor site probably null
R1489:Ap3b2 UTSW 7 81463690 nonsense probably null
R1542:Ap3b2 UTSW 7 81478077 splice site probably null
R1652:Ap3b2 UTSW 7 81473399 missense probably damaging 1.00
R1741:Ap3b2 UTSW 7 81467599 missense possibly damaging 0.95
R1872:Ap3b2 UTSW 7 81464150 missense unknown
R2065:Ap3b2 UTSW 7 81463774 missense unknown
R2353:Ap3b2 UTSW 7 81473850 unclassified probably benign
R2354:Ap3b2 UTSW 7 81473850 unclassified probably benign
R2398:Ap3b2 UTSW 7 81477195 missense probably damaging 0.99
R3421:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3710:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3933:Ap3b2 UTSW 7 81473850 unclassified probably benign
R4152:Ap3b2 UTSW 7 81478017 missense probably damaging 1.00
R4209:Ap3b2 UTSW 7 81477136 missense probably benign 0.02
R4732:Ap3b2 UTSW 7 81471932 missense probably damaging 1.00
R4733:Ap3b2 UTSW 7 81471932 missense probably damaging 1.00
R4841:Ap3b2 UTSW 7 81477930 missense probably damaging 1.00
R5207:Ap3b2 UTSW 7 81476769 missense possibly damaging 0.48
R5659:Ap3b2 UTSW 7 81476752 missense probably damaging 0.98
R6109:Ap3b2 UTSW 7 81493592 missense possibly damaging 0.55
R6223:Ap3b2 UTSW 7 81473462 nonsense probably null
R6901:Ap3b2 UTSW 7 81484912 critical splice acceptor site probably null
R6981:Ap3b2 UTSW 7 81477993 missense probably damaging 1.00
R7061:Ap3b2 UTSW 7 81461009 missense unknown
R7317:Ap3b2 UTSW 7 81461028 missense unknown
R7501:Ap3b2 UTSW 7 81473446 missense probably damaging 0.99
R7543:Ap3b2 UTSW 7 81466146 splice site probably null
R7643:Ap3b2 UTSW 7 81477072 missense probably benign 0.24
R7707:Ap3b2 UTSW 7 81476782 missense possibly damaging 0.60
R8111:Ap3b2 UTSW 7 81463782 missense unknown
R8273:Ap3b2 UTSW 7 81463242 missense unknown
X0013:Ap3b2 UTSW 7 81463240 critical splice donor site probably null
X0028:Ap3b2 UTSW 7 81463764 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAACTCATCATGCCAGAGATTAAG -3'
(R):5'- AGAGCTGCCCTGAGTATTGC -3'

Sequencing Primer
(F):5'- TGGGGAACTATGATGTCTCCAAACC -3'
(R):5'- AGCTGCCCTGAGTATTGCTTTCTAG -3'
Posted On2015-04-17