Incidental Mutation 'R3932:Vmn2r85'
ID308509
Institutional Source Beutler Lab
Gene Symbol Vmn2r85
Ensembl Gene ENSMUSG00000092048
Gene Namevomeronasal 2, receptor 85
SynonymsEG623734
MMRRC Submission 040919-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R3932 (G1)
Quality Score99
Status Not validated
Chromosome10
Chromosomal Location130417772-130429612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130418467 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 783 (M783V)
Ref Sequence ENSEMBL: ENSMUSP00000128792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171811]
Predicted Effect probably damaging
Transcript: ENSMUST00000171811
AA Change: M783V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128792
Gene: ENSMUSG00000092048
AA Change: M783V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 77 425 9e-26 PFAM
Pfam:NCD3G 508 562 1.1e-18 PFAM
Pfam:7tm_3 595 831 3.7e-54 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b2 C T 7: 81,473,850 probably benign Het
Arl1 C T 10: 88,733,536 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp10a T C 7: 58,827,104 M1189T possibly damaging Het
BC051142 A G 17: 34,443,443 T86A possibly damaging Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
Cdc34b G A 11: 94,742,615 V214M probably benign Het
Cfap54 T C 10: 92,829,757 T2985A probably benign Het
Clcc1 T C 3: 108,673,366 M332T probably damaging Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ctdnep1 A G 11: 69,989,574 probably benign Het
Edar C T 10: 58,610,342 C221Y probably damaging Het
Fam135b T A 15: 71,450,431 Q1295L probably benign Het
Fam184a C T 10: 53,699,301 A71T probably damaging Het
Fbxw10 A G 11: 62,869,157 probably benign Het
Frmd4a T C 2: 4,537,260 W247R probably damaging Het
Gcn1l1 A G 5: 115,587,834 H553R probably benign Het
Grin3a C T 4: 49,672,472 probably null Het
H2-Q6 C T 17: 35,425,566 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Med10 A G 13: 69,809,982 N18D probably damaging Het
Mgat4b T A 11: 50,233,338 H368Q possibly damaging Het
Morn5 C A 2: 36,053,023 T45N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Myrf T C 19: 10,218,151 T432A probably damaging Het
Nav3 T A 10: 109,694,035 E2148D probably damaging Het
Nfe2l3 A G 6: 51,456,615 T236A possibly damaging Het
Odc1 T A 12: 17,548,800 F227Y probably benign Het
Olfr1444 T C 19: 12,862,630 M285T possibly damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Pdcd1 T C 1: 94,041,264 I110V probably benign Het
Pde5a G A 3: 122,760,896 E212K probably damaging Het
Plin4 A G 17: 56,106,704 I307T probably benign Het
Rag1 T C 2: 101,643,039 Y586C probably damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rgs9 A G 11: 109,275,813 probably benign Het
Rin3 A G 12: 102,390,083 D961G probably damaging Het
Rubcn A G 16: 32,829,259 probably null Het
Slc13a2 T A 11: 78,398,400 Y495F probably damaging Het
Tfec T A 6: 16,845,459 D67V probably damaging Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Tmem94 T C 11: 115,789,254 M30T probably benign Het
Tubgcp6 A G 15: 89,104,414 probably benign Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Zfp94 T G 7: 24,303,687 D110A probably benign Het
Other mutations in Vmn2r85
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Vmn2r85 APN 10 130418821 missense probably benign 0.22
IGL01298:Vmn2r85 APN 10 130418821 missense probably benign 0.22
IGL01361:Vmn2r85 APN 10 130418821 missense probably benign 0.22
IGL02185:Vmn2r85 APN 10 130418692 missense probably benign 0.13
IGL02505:Vmn2r85 APN 10 130425580 missense probably damaging 1.00
IGL02607:Vmn2r85 APN 10 130426421 missense possibly damaging 0.89
IGL02755:Vmn2r85 APN 10 130425512 missense probably damaging 0.98
IGL03188:Vmn2r85 APN 10 130418743 missense probably benign 0.16
IGL03366:Vmn2r85 APN 10 130426459 missense probably benign 0.00
IGL03397:Vmn2r85 APN 10 130425394 missense probably damaging 1.00
PIT4445001:Vmn2r85 UTSW 10 130425703 missense probably benign 0.00
R0066:Vmn2r85 UTSW 10 130425901 missense probably damaging 1.00
R0128:Vmn2r85 UTSW 10 130419185 splice site probably benign
R0130:Vmn2r85 UTSW 10 130419185 splice site probably benign
R0503:Vmn2r85 UTSW 10 130422740 missense probably damaging 1.00
R0827:Vmn2r85 UTSW 10 130429518 missense possibly damaging 0.89
R1432:Vmn2r85 UTSW 10 130425286 missense possibly damaging 0.74
R1521:Vmn2r85 UTSW 10 130425919 missense probably damaging 0.99
R2029:Vmn2r85 UTSW 10 130425574 nonsense probably null
R2034:Vmn2r85 UTSW 10 130426373 splice site probably benign
R2852:Vmn2r85 UTSW 10 130419166 missense probably benign 0.03
R2853:Vmn2r85 UTSW 10 130419166 missense probably benign 0.03
R3084:Vmn2r85 UTSW 10 130425212 missense probably benign 0.00
R3085:Vmn2r85 UTSW 10 130425212 missense probably benign 0.00
R3430:Vmn2r85 UTSW 10 130418889 missense probably damaging 0.97
R3694:Vmn2r85 UTSW 10 130418302 missense probably damaging 0.99
R4207:Vmn2r85 UTSW 10 130418705 missense probably damaging 1.00
R4628:Vmn2r85 UTSW 10 130425366 missense probably benign 0.00
R4814:Vmn2r85 UTSW 10 130418698 missense probably benign 0.12
R4948:Vmn2r85 UTSW 10 130419121 missense probably damaging 1.00
R4951:Vmn2r85 UTSW 10 130425244 missense probably damaging 1.00
R4959:Vmn2r85 UTSW 10 130421433 missense probably damaging 1.00
R5336:Vmn2r85 UTSW 10 130422705 missense possibly damaging 0.63
R5643:Vmn2r85 UTSW 10 130426474 missense probably damaging 1.00
R6061:Vmn2r85 UTSW 10 130425662 missense probably benign 0.09
R6115:Vmn2r85 UTSW 10 130422803 missense probably damaging 1.00
R6190:Vmn2r85 UTSW 10 130425461 missense possibly damaging 0.88
R6518:Vmn2r85 UTSW 10 130429412 missense probably benign 0.00
R6533:Vmn2r85 UTSW 10 130426660 missense probably benign 0.00
R6610:Vmn2r85 UTSW 10 130425969 missense probably damaging 0.97
R6809:Vmn2r85 UTSW 10 130425926 missense probably benign
R6962:Vmn2r85 UTSW 10 130425583 missense probably damaging 0.99
R7075:Vmn2r85 UTSW 10 130422688 missense probably benign 0.06
R7104:Vmn2r85 UTSW 10 130426507 missense probably benign
R7424:Vmn2r85 UTSW 10 130418980 missense probably damaging 1.00
R7516:Vmn2r85 UTSW 10 130418983 missense probably damaging 1.00
R7537:Vmn2r85 UTSW 10 130422866 missense probably benign 0.01
R7768:Vmn2r85 UTSW 10 130418693 missense probably damaging 1.00
R7810:Vmn2r85 UTSW 10 130425212 missense probably benign 0.00
R8078:Vmn2r85 UTSW 10 130429495 nonsense probably null
R8115:Vmn2r85 UTSW 10 130425951 missense probably benign 0.06
R8262:Vmn2r85 UTSW 10 130418869 missense probably damaging 0.98
R8395:Vmn2r85 UTSW 10 130425928 missense probably damaging 0.99
R8409:Vmn2r85 UTSW 10 130425388 missense probably benign 0.16
Z1176:Vmn2r85 UTSW 10 130425844 missense probably damaging 0.99
Z1177:Vmn2r85 UTSW 10 130418907 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTGCTGTCCTGTTTGTAAGTTC -3'
(R):5'- CAATCTGAACATGGGAAGACTG -3'

Sequencing Primer
(F):5'- CTTCTGTATAAAATGTGAGTCTGGTC -3'
(R):5'- AACACAGGCTCTGTCCTT -3'
Posted On2015-04-17