Incidental Mutation 'R0379:Fbxl4'
ID30851
Institutional Source Beutler Lab
Gene Symbol Fbxl4
Ensembl Gene ENSMUSG00000040410
Gene NameF-box and leucine-rich repeat protein 4
SynonymsFBL5, FBL4
MMRRC Submission 038585-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R0379 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location22357543-22434091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22386106 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 238 (T238A)
Ref Sequence ENSEMBL: ENSMUSP00000138841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039234] [ENSMUST00000184455] [ENSMUST00000184582] [ENSMUST00000185029]
Predicted Effect probably benign
Transcript: ENSMUST00000039234
AA Change: T238A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000042219
Gene: ENSMUSG00000040410
AA Change: T238A

DomainStartEndE-ValueType
FBOX 283 325 2.11e-3 SMART
Blast:LRR 344 372 1e-6 BLAST
LRR 400 425 1.95e-3 SMART
LRR 450 475 1.01e-1 SMART
LRR_CC 478 503 4.14e-7 SMART
LRR 504 524 1.16e2 SMART
LRR 532 557 3.69e1 SMART
LRR 558 583 8.71e0 SMART
LRR 584 609 1.64e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184455
AA Change: T238A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000184582
AA Change: T238A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139158
Gene: ENSMUSG00000040410
AA Change: T238A

DomainStartEndE-ValueType
FBOX 283 325 2.11e-3 SMART
Blast:LRR 344 372 1e-6 BLAST
LRR 400 425 1.95e-3 SMART
LRR 450 475 1.01e-1 SMART
LRR_CC 478 503 4.14e-7 SMART
LRR 504 524 1.16e2 SMART
LRR 532 557 3.69e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185029
AA Change: T238A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000138825
Gene: ENSMUSG00000040410
AA Change: T238A

DomainStartEndE-ValueType
FBOX 283 325 2.11e-3 SMART
Blast:LRR 344 372 1e-7 BLAST
Blast:LRR 400 425 2e-9 BLAST
Meta Mutation Damage Score 0.0601 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, which are characterized by an approximately 40 amino acid motif, the F-box. F-box proteins constitute one subunit of modular E3 ubiquitin ligase complexes, called SCF complexes, which function in phosphorylation-dependent ubiquitination. The F-box domain mediates protein-protein interactions and binds directly to S-phase kinase-associated protein 1. In addition to an F-box domain, the encoded protein contains at least 9 tandem leucine-rich repeats. The ubiquitin ligase complex containing the encoded protein may function in cell-cycle control by regulating levels of lysine-specific demethylase 4A. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,785,546 probably benign Het
4930512M02Rik A G 11: 11,589,365 probably benign Het
Apba1 A C 19: 23,934,830 N558T probably damaging Het
Arfgef2 T A 2: 166,860,400 probably null Het
Arsb T C 13: 93,940,627 S501P probably benign Het
Atp10b A G 11: 43,254,314 T1295A probably benign Het
Atp8b5 G T 4: 43,361,898 R648L probably damaging Het
Bcl2a1b T C 9: 89,199,736 I126T possibly damaging Het
Brd9 T C 13: 73,942,683 probably benign Het
Cd93 T C 2: 148,441,510 probably benign Het
Chd5 A G 4: 152,383,321 K1692R probably benign Het
Clcn4 T C 7: 7,296,792 T13A probably damaging Het
Clec14a A G 12: 58,268,794 F14S possibly damaging Het
Clec4g A G 8: 3,718,440 V97A probably benign Het
Col24a1 G A 3: 145,524,142 R1483K possibly damaging Het
Crem A T 18: 3,299,226 V82D probably damaging Het
Ctnna2 T A 6: 77,641,440 T180S probably benign Het
Cybrd1 T C 2: 71,129,755 I99T probably benign Het
Cyp4a32 G A 4: 115,621,474 V468M probably damaging Het
Dlk1 A G 12: 109,455,059 probably benign Het
Dnah7b A T 1: 46,140,176 Y1003F probably benign Het
Egfem1 A C 3: 29,668,250 E376A possibly damaging Het
Etl4 T A 2: 20,807,354 I1416K probably damaging Het
Fer1l6 A G 15: 58,548,338 I33M probably benign Het
Fndc3a A G 14: 72,556,609 S830P probably damaging Het
Fras1 C T 5: 96,755,509 R3082* probably null Het
Galnt13 T C 2: 55,060,492 V395A possibly damaging Het
Gm10334 T G 6: 41,445,256 probably benign Het
Gpd2 C T 2: 57,345,263 T335I probably damaging Het
Gucy2d C A 7: 98,459,002 probably null Het
Hydin A G 8: 110,509,127 probably benign Het
Ints5 G T 19: 8,897,133 V819L possibly damaging Het
Klhdc10 C G 6: 30,450,670 Q292E possibly damaging Het
Lmbrd2 G A 15: 9,149,479 A67T probably benign Het
Lrp1 T G 10: 127,594,969 T404P probably damaging Het
March7 T C 2: 60,234,126 S249P probably benign Het
Mcm10 T A 2: 5,008,623 K66M probably benign Het
Mtmr7 C A 8: 40,551,601 D645Y probably damaging Het
Muc6 T A 7: 141,636,955 I2602F possibly damaging Het
Myh13 G A 11: 67,369,295 probably benign Het
Myo18a G A 11: 77,850,806 V1776I possibly damaging Het
Ncapg2 T C 12: 116,443,075 L957S probably damaging Het
Ncoa3 T C 2: 166,054,502 S442P probably damaging Het
Olfr1093 G A 2: 86,785,735 E2K probably benign Het
Olfr850 T A 9: 19,477,480 T257S possibly damaging Het
Olfr986 G A 9: 40,187,433 G106D probably damaging Het
Pdcd6 G T 13: 74,309,712 N113K possibly damaging Het
Pfkfb4 C T 9: 109,027,742 probably benign Het
Pfkm A G 15: 98,126,314 H401R probably benign Het
Phldb2 C A 16: 45,781,451 D754Y probably damaging Het
Plekhb2 T A 1: 34,863,114 M49K probably damaging Het
Polrmt A G 10: 79,737,611 S1057P possibly damaging Het
Prps1l1 A G 12: 34,985,078 N64S probably benign Het
Psg16 T C 7: 17,130,658 S393P probably benign Het
Rundc1 C T 11: 101,425,147 T15I probably benign Het
Scaf11 A G 15: 96,431,816 L143S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpinf1 T G 11: 75,413,945 I197L probably benign Het
Siglec1 C T 2: 131,074,525 probably benign Het
Slc28a1 G A 7: 81,138,177 V271I probably benign Het
Sntg1 T C 1: 8,782,824 D34G probably damaging Het
Sptbn4 A T 7: 27,359,736 probably benign Het
Suclg1 T C 6: 73,256,228 I51T possibly damaging Het
Syne1 C T 10: 5,541,989 R9Q probably damaging Het
Trim47 T A 11: 116,106,518 H470L probably damaging Het
Ttc41 T A 10: 86,712,977 Y12N possibly damaging Het
Tubgcp2 T C 7: 140,032,192 E69G probably damaging Het
Tubgcp3 G A 8: 12,641,116 T474M probably damaging Het
Ubr5 A T 15: 38,018,957 N777K probably benign Het
Ush2a T C 1: 188,451,819 L1440P probably damaging Het
Usp28 A C 9: 49,024,067 D458A possibly damaging Het
Vcan A T 13: 89,703,546 D1098E probably damaging Het
Vmn1r73 C T 7: 11,756,846 T197I probably benign Het
Vmn2r15 T C 5: 109,286,478 S787G probably damaging Het
Vmn2r90 T A 17: 17,728,139 I549N probably damaging Het
Vps33b T A 7: 80,283,414 probably null Het
Zfp516 A T 18: 82,987,670 K900* probably null Het
Zfp974 T A 7: 27,910,932 N456I probably damaging Het
Other mutations in Fbxl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Fbxl4 APN 4 22427348 missense probably benign 0.01
IGL01973:Fbxl4 APN 4 22422766 missense probably damaging 1.00
IGL02353:Fbxl4 APN 4 22433684 missense probably benign 0.00
IGL02360:Fbxl4 APN 4 22433684 missense probably benign 0.00
IGL02871:Fbxl4 APN 4 22386213 missense probably benign
R0033:Fbxl4 UTSW 4 22377017 missense probably damaging 1.00
R1053:Fbxl4 UTSW 4 22427166 missense probably benign
R1527:Fbxl4 UTSW 4 22386154 missense probably benign 0.00
R1768:Fbxl4 UTSW 4 22385950 missense probably benign 0.00
R2148:Fbxl4 UTSW 4 22427333 missense possibly damaging 0.65
R2196:Fbxl4 UTSW 4 22403624 missense probably benign
R2850:Fbxl4 UTSW 4 22403624 missense probably benign
R4024:Fbxl4 UTSW 4 22377074 missense possibly damaging 0.83
R4425:Fbxl4 UTSW 4 22422699 splice site probably null
R5227:Fbxl4 UTSW 4 22376840 missense probably damaging 1.00
R5499:Fbxl4 UTSW 4 22386017 missense probably damaging 1.00
R5595:Fbxl4 UTSW 4 22433641 missense probably damaging 1.00
R5895:Fbxl4 UTSW 4 22390678 missense probably damaging 1.00
R6475:Fbxl4 UTSW 4 22433661 missense probably damaging 1.00
R6697:Fbxl4 UTSW 4 22376599 missense probably benign 0.33
R6977:Fbxl4 UTSW 4 22376930 missense probably benign 0.22
R7106:Fbxl4 UTSW 4 22427140 splice site probably null
R7164:Fbxl4 UTSW 4 22386218 missense probably benign 0.00
R7264:Fbxl4 UTSW 4 22386145 missense possibly damaging 0.94
R7502:Fbxl4 UTSW 4 22376655 missense probably benign
R7645:Fbxl4 UTSW 4 22377037 missense probably damaging 1.00
R7666:Fbxl4 UTSW 4 22376869 missense probably benign 0.07
R8152:Fbxl4 UTSW 4 22427225 missense possibly damaging 0.77
R8445:Fbxl4 UTSW 4 22385983 missense probably benign 0.07
Z1176:Fbxl4 UTSW 4 22427280 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGGTGAATGCTTCCCAGGCTC -3'
(R):5'- CGACCCCAGGGTGTTAGAAACAAG -3'

Sequencing Primer
(F):5'- GCTTCCCAGGCTCGTCAG -3'
(R):5'- TTTGACATCACATAGCTACCGAG -3'
Posted On2013-04-24