Incidental Mutation 'R3932:Mgat4b'
ID308510
Institutional Source Beutler Lab
Gene Symbol Mgat4b
Ensembl Gene ENSMUSG00000036620
Gene Namemannoside acetylglucosaminyltransferase 4, isoenzyme B
Synonyms
MMRRC Submission 040919-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3932 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location50210890-50235103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50233338 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 368 (H368Q)
Ref Sequence ENSEMBL: ENSMUSP00000043346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041725] [ENSMUST00000101265] [ENSMUST00000102772] [ENSMUST00000125555] [ENSMUST00000147468] [ENSMUST00000221525]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041725
AA Change: H368Q

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000043346
Gene: ENSMUSG00000036620
AA Change: H368Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Glyco_transf_54 98 387 6.6e-138 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101265
SMART Domains Protein: ENSMUSP00000098823
Gene: ENSMUSG00000020377

DomainStartEndE-ValueType
Pfam:MAPEG 8 112 4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102772
SMART Domains Protein: ENSMUSP00000099833
Gene: ENSMUSG00000020377

DomainStartEndE-ValueType
Pfam:MAPEG 8 131 1.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122977
Predicted Effect probably benign
Transcript: ENSMUST00000125555
SMART Domains Protein: ENSMUSP00000121584
Gene: ENSMUSG00000020377

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 64 83 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133714
Predicted Effect probably benign
Transcript: ENSMUST00000147468
Predicted Effect probably benign
Transcript: ENSMUST00000151803
SMART Domains Protein: ENSMUSP00000116802
Gene: ENSMUSG00000036620

DomainStartEndE-ValueType
Pfam:Glyco_transf_54 46 252 1.9e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221391
Predicted Effect probably benign
Transcript: ENSMUST00000221525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222498
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a key glycosyltransferase that regulates the formation of tri- and multiantennary branching structures in the Golgi apparatus. The encoded protein, in addition to the related isoenzyme A, catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc in a beta-1,4 linkage to the Man-alpha-1,3-Man-beta-1,4-GlcNAc arm of R-Man-alpha-1,6(GlcNAc-beta-1,2-Man-alpha-1,3)Man-beta-1,4-GlcNAc-beta-1,4-GlcNAc-beta-1-Asn. The encoded protein may play a role in regulating the availability of serum glycoproteins, oncogenesis, and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a floxed targeted allele are viable and do not display any gross physical or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b2 C T 7: 81,473,850 probably benign Het
Arl1 C T 10: 88,733,536 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp10a T C 7: 58,827,104 M1189T possibly damaging Het
BC051142 A G 17: 34,443,443 T86A possibly damaging Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
Cdc34b G A 11: 94,742,615 V214M probably benign Het
Cfap54 T C 10: 92,829,757 T2985A probably benign Het
Clcc1 T C 3: 108,673,366 M332T probably damaging Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ctdnep1 A G 11: 69,989,574 probably benign Het
Edar C T 10: 58,610,342 C221Y probably damaging Het
Fam135b T A 15: 71,450,431 Q1295L probably benign Het
Fam184a C T 10: 53,699,301 A71T probably damaging Het
Fbxw10 A G 11: 62,869,157 probably benign Het
Frmd4a T C 2: 4,537,260 W247R probably damaging Het
Gcn1l1 A G 5: 115,587,834 H553R probably benign Het
Grin3a C T 4: 49,672,472 probably null Het
H2-Q6 C T 17: 35,425,566 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Med10 A G 13: 69,809,982 N18D probably damaging Het
Morn5 C A 2: 36,053,023 T45N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Myrf T C 19: 10,218,151 T432A probably damaging Het
Nav3 T A 10: 109,694,035 E2148D probably damaging Het
Nfe2l3 A G 6: 51,456,615 T236A possibly damaging Het
Odc1 T A 12: 17,548,800 F227Y probably benign Het
Olfr1444 T C 19: 12,862,630 M285T possibly damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Pdcd1 T C 1: 94,041,264 I110V probably benign Het
Pde5a G A 3: 122,760,896 E212K probably damaging Het
Plin4 A G 17: 56,106,704 I307T probably benign Het
Rag1 T C 2: 101,643,039 Y586C probably damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rgs9 A G 11: 109,275,813 probably benign Het
Rin3 A G 12: 102,390,083 D961G probably damaging Het
Rubcn A G 16: 32,829,259 probably null Het
Slc13a2 T A 11: 78,398,400 Y495F probably damaging Het
Tfec T A 6: 16,845,459 D67V probably damaging Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Tmem94 T C 11: 115,789,254 M30T probably benign Het
Tubgcp6 A G 15: 89,104,414 probably benign Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r85 T C 10: 130,418,467 M783V probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Zfp94 T G 7: 24,303,687 D110A probably benign Het
Other mutations in Mgat4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01628:Mgat4b APN 11 50233309 missense probably benign 0.01
IGL01980:Mgat4b APN 11 50230713 missense probably damaging 1.00
IGL02533:Mgat4b APN 11 50233552 missense probably damaging 0.99
IGL02729:Mgat4b APN 11 50233309 missense probably benign 0.01
IGL02888:Mgat4b APN 11 50232332 missense probably damaging 1.00
IGL03369:Mgat4b APN 11 50234109 missense possibly damaging 0.79
R0085:Mgat4b UTSW 11 50230999 missense possibly damaging 0.87
R0136:Mgat4b UTSW 11 50231081 missense possibly damaging 0.91
R0394:Mgat4b UTSW 11 50230919 splice site probably null
R0631:Mgat4b UTSW 11 50230763 missense probably damaging 1.00
R0657:Mgat4b UTSW 11 50231081 missense possibly damaging 0.91
R4419:Mgat4b UTSW 11 50232986 missense probably damaging 0.99
R4816:Mgat4b UTSW 11 50211021 missense probably benign 0.01
R6315:Mgat4b UTSW 11 50231764 missense probably damaging 1.00
R6677:Mgat4b UTSW 11 50233071 splice site probably null
R6786:Mgat4b UTSW 11 50230698 missense probably damaging 1.00
R7053:Mgat4b UTSW 11 50233540 missense probably damaging 1.00
R7798:Mgat4b UTSW 11 50225670 missense possibly damaging 0.91
R8042:Mgat4b UTSW 11 50232376 nonsense probably null
R8165:Mgat4b UTSW 11 50210974 missense probably benign 0.09
R8428:Mgat4b UTSW 11 50230685 missense probably benign 0.01
R8859:Mgat4b UTSW 11 50230847 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGCCTCTATAGCAAGGAGAGG -3'
(R):5'- GGGTGAAATGCTGGTACGTC -3'

Sequencing Primer
(F):5'- GAAACTGCTGGCTGAGGAAATCC -3'
(R):5'- AAATGCTGGTACGTCTTGAGGC -3'
Posted On2015-04-17