Incidental Mutation 'R3932:Coch'
ID308520
Institutional Source Beutler Lab
Gene Symbol Coch
Ensembl Gene ENSMUSG00000020953
Gene Namecochlin
SynonymsCoch-5B2, D12H14S564E
MMRRC Submission 040919-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3932 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location51593341-51605771 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51603338 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 370 (I370T)
Ref Sequence ENSEMBL: ENSMUSP00000128127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085412] [ENSMUST00000164782]
Predicted Effect probably damaging
Transcript: ENSMUST00000085412
AA Change: I370T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000082533
Gene: ENSMUSG00000020953
AA Change: I370T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LCCL 32 114 3.64e-47 SMART
VWA 165 337 2.06e-33 SMART
VWA 367 540 6.43e-44 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164782
AA Change: I370T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128127
Gene: ENSMUSG00000020953
AA Change: I370T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LCCL 32 114 3.64e-47 SMART
VWA 165 337 2.06e-33 SMART
VWA 367 540 6.43e-44 SMART
Meta Mutation Damage Score 0.9273 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly conserved in human, mouse, and chicken, showing 94% and 79% amino acid identity of human to mouse and chicken sequences, respectively. Hybridization to this gene was detected in spindle-shaped cells located along nerve fibers between the auditory ganglion and sensory epithelium. These cells accompany neurites at the habenula perforata, the opening through which neurites extend to innervate hair cells. This and the pattern of expression of this gene in chicken inner ear paralleled the histologic findings of acidophilic deposits, consistent with mucopolysaccharide ground substance, in temporal bones from DFNA9 (autosomal dominant nonsyndromic sensorineural deafness 9) patients. Mutations that cause DFNA9 have been reported in this gene. Alternative splicing results in multiple transcript variants encoding the same protein. Additional splice variants encoding distinct isoforms have been described but their biological validities have not been demonstrated. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for a point mutation have vestibular and hearing dysfunctions that worsen with age. Homozyogtes for a null allele have no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b2 C T 7: 81,473,850 probably benign Het
Arl1 C T 10: 88,733,536 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp10a T C 7: 58,827,104 M1189T possibly damaging Het
BC051142 A G 17: 34,443,443 T86A possibly damaging Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
Cdc34b G A 11: 94,742,615 V214M probably benign Het
Cfap54 T C 10: 92,829,757 T2985A probably benign Het
Clcc1 T C 3: 108,673,366 M332T probably damaging Het
Ctdnep1 A G 11: 69,989,574 probably benign Het
Edar C T 10: 58,610,342 C221Y probably damaging Het
Fam135b T A 15: 71,450,431 Q1295L probably benign Het
Fam184a C T 10: 53,699,301 A71T probably damaging Het
Fbxw10 A G 11: 62,869,157 probably benign Het
Frmd4a T C 2: 4,537,260 W247R probably damaging Het
Gcn1l1 A G 5: 115,587,834 H553R probably benign Het
Grin3a C T 4: 49,672,472 probably null Het
H2-Q6 C T 17: 35,425,566 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Med10 A G 13: 69,809,982 N18D probably damaging Het
Mgat4b T A 11: 50,233,338 H368Q possibly damaging Het
Morn5 C A 2: 36,053,023 T45N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Myrf T C 19: 10,218,151 T432A probably damaging Het
Nav3 T A 10: 109,694,035 E2148D probably damaging Het
Nfe2l3 A G 6: 51,456,615 T236A possibly damaging Het
Odc1 T A 12: 17,548,800 F227Y probably benign Het
Olfr1444 T C 19: 12,862,630 M285T possibly damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Pdcd1 T C 1: 94,041,264 I110V probably benign Het
Pde5a G A 3: 122,760,896 E212K probably damaging Het
Plin4 A G 17: 56,106,704 I307T probably benign Het
Rag1 T C 2: 101,643,039 Y586C probably damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rgs9 A G 11: 109,275,813 probably benign Het
Rin3 A G 12: 102,390,083 D961G probably damaging Het
Rubcn A G 16: 32,829,259 probably null Het
Slc13a2 T A 11: 78,398,400 Y495F probably damaging Het
Tfec T A 6: 16,845,459 D67V probably damaging Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Tmem94 T C 11: 115,789,254 M30T probably benign Het
Tubgcp6 A G 15: 89,104,414 probably benign Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r85 T C 10: 130,418,467 M783V probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Zfp94 T G 7: 24,303,687 D110A probably benign Het
Other mutations in Coch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01514:Coch APN 12 51603353 missense probably damaging 1.00
IGL01803:Coch APN 12 51603299 missense probably benign 0.15
IGL02613:Coch APN 12 51595349 missense possibly damaging 0.76
IGL02697:Coch APN 12 51597038 missense probably benign 0.00
IGL03351:Coch APN 12 51603206 missense probably benign 0.05
R0732:Coch UTSW 12 51595372 missense probably damaging 1.00
R1485:Coch UTSW 12 51598289 missense probably damaging 1.00
R1757:Coch UTSW 12 51602848 missense probably damaging 1.00
R2073:Coch UTSW 12 51602689 missense probably benign 0.00
R2231:Coch UTSW 12 51602865 missense probably benign
R2440:Coch UTSW 12 51596562 missense probably damaging 0.99
R3104:Coch UTSW 12 51603421 missense probably benign
R3623:Coch UTSW 12 51602826 missense probably benign 0.06
R3624:Coch UTSW 12 51602826 missense probably benign 0.06
R3933:Coch UTSW 12 51603338 missense probably damaging 1.00
R3945:Coch UTSW 12 51601812 critical splice acceptor site probably null
R3946:Coch UTSW 12 51601812 critical splice acceptor site probably null
R4423:Coch UTSW 12 51598149 splice site probably null
R4660:Coch UTSW 12 51595485 missense probably benign 0.21
R4732:Coch UTSW 12 51605019 missense probably benign 0.28
R4733:Coch UTSW 12 51605019 missense probably benign 0.28
R4844:Coch UTSW 12 51602694 missense probably damaging 0.98
R4997:Coch UTSW 12 51603181 splice site probably null
R5152:Coch UTSW 12 51595442 missense probably benign 0.00
R5173:Coch UTSW 12 51596507 nonsense probably null
R6134:Coch UTSW 12 51602753 missense probably damaging 1.00
R6481:Coch UTSW 12 51598173 missense probably damaging 1.00
R6497:Coch UTSW 12 51602721 missense probably benign 0.06
R6714:Coch UTSW 12 51602737 missense probably damaging 1.00
R6896:Coch UTSW 12 51602869 missense possibly damaging 0.62
R7242:Coch UTSW 12 51593561 start gained probably benign
R7463:Coch UTSW 12 51593625 start codon destroyed probably null 0.02
R7595:Coch UTSW 12 51598233 missense probably damaging 1.00
R8047:Coch UTSW 12 51603713 critical splice donor site probably null
R8085:Coch UTSW 12 51603248 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GCATAAGGTTCTAGGTTCATTCTC -3'
(R):5'- AGGACAGCTAGGACGTTCTC -3'

Sequencing Primer
(F):5'- AAGGTTCTAGGTTCATTCTCCATTAC -3'
(R):5'- ACAGCTAGGACGTTCTCTTTGG -3'
Posted On2015-04-17