Incidental Mutation 'R3932:Rin3'
ID308521
Institutional Source Beutler Lab
Gene Symbol Rin3
Ensembl Gene ENSMUSG00000044456
Gene NameRas and Rab interactor 3
Synonyms
MMRRC Submission 040919-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3932 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location102283048-102390855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102390083 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 961 (D961G)
Ref Sequence ENSEMBL: ENSMUSP00000060771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021607] [ENSMUST00000056950] [ENSMUST00000110020] [ENSMUST00000133820]
Predicted Effect probably benign
Transcript: ENSMUST00000021607
SMART Domains Protein: ENSMUSP00000021607
Gene: ENSMUSG00000021190

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:Peptidase_C13 31 288 8e-120 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000056950
AA Change: D961G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000060771
Gene: ENSMUSG00000044456
AA Change: D961G

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
SH2 61 149 1.89e-2 SMART
low complexity region 254 311 N/A INTRINSIC
low complexity region 316 325 N/A INTRINSIC
low complexity region 358 380 N/A INTRINSIC
low complexity region 448 469 N/A INTRINSIC
low complexity region 514 523 N/A INTRINSIC
low complexity region 579 594 N/A INTRINSIC
low complexity region 714 728 N/A INTRINSIC
VPS9 736 852 5.75e-38 SMART
RA 873 960 3.5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110020
SMART Domains Protein: ENSMUSP00000105647
Gene: ENSMUSG00000021190

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:Peptidase_C13 31 288 8e-120 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000133820
AA Change: D881G

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122646
Gene: ENSMUSG00000044456
AA Change: D881G

DomainStartEndE-ValueType
Blast:SH2 1 69 3e-39 BLAST
SCOP:d1a81a2 3 77 2e-4 SMART
low complexity region 174 231 N/A INTRINSIC
low complexity region 236 245 N/A INTRINSIC
low complexity region 278 300 N/A INTRINSIC
low complexity region 368 389 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 499 514 N/A INTRINSIC
low complexity region 634 648 N/A INTRINSIC
VPS9 656 772 5.75e-38 SMART
RA 793 880 3.5e-4 SMART
Meta Mutation Damage Score 0.1717 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Summary: This protein encoded by this gene is a member of the RIN family of Ras interaction-interference proteins, which are binding partners to the RAB5 small GTPases. The protein functions as a guanine nucleotide exchange for RAB5B and RAB31. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b2 C T 7: 81,473,850 probably benign Het
Arl1 C T 10: 88,733,536 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp10a T C 7: 58,827,104 M1189T possibly damaging Het
BC051142 A G 17: 34,443,443 T86A possibly damaging Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
Cdc34b G A 11: 94,742,615 V214M probably benign Het
Cfap54 T C 10: 92,829,757 T2985A probably benign Het
Clcc1 T C 3: 108,673,366 M332T probably damaging Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ctdnep1 A G 11: 69,989,574 probably benign Het
Edar C T 10: 58,610,342 C221Y probably damaging Het
Fam135b T A 15: 71,450,431 Q1295L probably benign Het
Fam184a C T 10: 53,699,301 A71T probably damaging Het
Fbxw10 A G 11: 62,869,157 probably benign Het
Frmd4a T C 2: 4,537,260 W247R probably damaging Het
Gcn1l1 A G 5: 115,587,834 H553R probably benign Het
Grin3a C T 4: 49,672,472 probably null Het
H2-Q6 C T 17: 35,425,566 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Med10 A G 13: 69,809,982 N18D probably damaging Het
Mgat4b T A 11: 50,233,338 H368Q possibly damaging Het
Morn5 C A 2: 36,053,023 T45N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Myrf T C 19: 10,218,151 T432A probably damaging Het
Nav3 T A 10: 109,694,035 E2148D probably damaging Het
Nfe2l3 A G 6: 51,456,615 T236A possibly damaging Het
Odc1 T A 12: 17,548,800 F227Y probably benign Het
Olfr1444 T C 19: 12,862,630 M285T possibly damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Pdcd1 T C 1: 94,041,264 I110V probably benign Het
Pde5a G A 3: 122,760,896 E212K probably damaging Het
Plin4 A G 17: 56,106,704 I307T probably benign Het
Rag1 T C 2: 101,643,039 Y586C probably damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rgs9 A G 11: 109,275,813 probably benign Het
Rubcn A G 16: 32,829,259 probably null Het
Slc13a2 T A 11: 78,398,400 Y495F probably damaging Het
Tfec T A 6: 16,845,459 D67V probably damaging Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Tmem94 T C 11: 115,789,254 M30T probably benign Het
Tubgcp6 A G 15: 89,104,414 probably benign Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r85 T C 10: 130,418,467 M783V probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Zfp94 T G 7: 24,303,687 D110A probably benign Het
Other mutations in Rin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Rin3 APN 12 102373603 missense probably damaging 1.00
IGL01521:Rin3 APN 12 102369048 missense probably benign 0.00
PIT4495001:Rin3 UTSW 12 102369036 missense probably benign 0.02
R0109:Rin3 UTSW 12 102313081 missense possibly damaging 0.74
R0109:Rin3 UTSW 12 102313081 missense possibly damaging 0.74
R0504:Rin3 UTSW 12 102387564 nonsense probably null
R0699:Rin3 UTSW 12 102369575 missense probably damaging 0.98
R1499:Rin3 UTSW 12 102368759 missense unknown
R1733:Rin3 UTSW 12 102369330 nonsense probably null
R1743:Rin3 UTSW 12 102390096 missense possibly damaging 0.87
R2911:Rin3 UTSW 12 102373584 missense probably benign 0.43
R2961:Rin3 UTSW 12 102313046 nonsense probably null
R3153:Rin3 UTSW 12 102368541 missense unknown
R4498:Rin3 UTSW 12 102369680 missense probably damaging 1.00
R4803:Rin3 UTSW 12 102361383 intron probably benign
R4985:Rin3 UTSW 12 102368562 missense unknown
R5300:Rin3 UTSW 12 102369670 missense probably benign 0.29
R5363:Rin3 UTSW 12 102325834 missense probably damaging 0.97
R5414:Rin3 UTSW 12 102389857 nonsense probably null
R5458:Rin3 UTSW 12 102373716 missense probably damaging 0.99
R5503:Rin3 UTSW 12 102313055 missense probably benign 0.17
R5534:Rin3 UTSW 12 102387632 missense probably damaging 1.00
R5599:Rin3 UTSW 12 102389929 missense probably damaging 1.00
R5752:Rin3 UTSW 12 102313119 start gained probably benign
R5874:Rin3 UTSW 12 102389843 missense probably damaging 1.00
R6467:Rin3 UTSW 12 102369325 missense probably benign 0.06
R7250:Rin3 UTSW 12 102368634 missense unknown
R7264:Rin3 UTSW 12 102390115 missense probably benign 0.01
R7514:Rin3 UTSW 12 102369650 nonsense probably null
R7534:Rin3 UTSW 12 102350941 missense unknown
R7837:Rin3 UTSW 12 102368765 missense unknown
R7875:Rin3 UTSW 12 102369476 missense probably damaging 1.00
R7983:Rin3 UTSW 12 102369159 missense probably benign 0.14
R8014:Rin3 UTSW 12 102361371 nonsense probably null
R8187:Rin3 UTSW 12 102325807 missense unknown
Z1177:Rin3 UTSW 12 102325862 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTGCGCTGAGAAGTTTGAG -3'
(R):5'- ACTAAGAACTTGGTGCCTCAG -3'

Sequencing Primer
(F):5'- AAGTTTGAGGTGTCACAGCCC -3'
(R):5'- CAGGCAATGACTCTACCTGATTGG -3'
Posted On2015-04-17