Incidental Mutation 'R3932:Rgs7bp'
ID308523
Institutional Source Beutler Lab
Gene Symbol Rgs7bp
Ensembl Gene ENSMUSG00000021719
Gene Nameregulator of G-protein signalling 7 binding protein
SynonymsD13Bwg1146e, R7bp, A930030I01Rik
MMRRC Submission 040919-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3932 (G1)
Quality Score220
Status Validated
Chromosome13
Chromosomal Location104945904-105054930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105052998 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 98 (M98V)
Ref Sequence ENSEMBL: ENSMUSP00000066614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063551]
Predicted Effect probably benign
Transcript: ENSMUST00000063551
AA Change: M98V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000066614
Gene: ENSMUSG00000021719
AA Change: M98V

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
coiled coil region 194 221 N/A INTRINSIC
Meta Mutation Damage Score 0.0585 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to all members of the R7 subfamily of regulators of G protein signaling and regulates their translocation between the nucleus and the plasma membrane. The encoded protein could be regulated by reversible palmitoylation, which anchors it to the plasma membrane. Depalmitoylation localizes the protein to the nucleus. Polymorphisms in this gene may be associated with risk of aspirin-exacerbated respiratory disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit normal behavior and brain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b2 C T 7: 81,473,850 probably benign Het
Arl1 C T 10: 88,733,536 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp10a T C 7: 58,827,104 M1189T possibly damaging Het
BC051142 A G 17: 34,443,443 T86A possibly damaging Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
Cdc34b G A 11: 94,742,615 V214M probably benign Het
Cfap54 T C 10: 92,829,757 T2985A probably benign Het
Clcc1 T C 3: 108,673,366 M332T probably damaging Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ctdnep1 A G 11: 69,989,574 probably benign Het
Edar C T 10: 58,610,342 C221Y probably damaging Het
Fam135b T A 15: 71,450,431 Q1295L probably benign Het
Fam184a C T 10: 53,699,301 A71T probably damaging Het
Fbxw10 A G 11: 62,869,157 probably benign Het
Frmd4a T C 2: 4,537,260 W247R probably damaging Het
Gcn1l1 A G 5: 115,587,834 H553R probably benign Het
Grin3a C T 4: 49,672,472 probably null Het
H2-Q6 C T 17: 35,425,566 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Med10 A G 13: 69,809,982 N18D probably damaging Het
Mgat4b T A 11: 50,233,338 H368Q possibly damaging Het
Morn5 C A 2: 36,053,023 T45N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Myrf T C 19: 10,218,151 T432A probably damaging Het
Nav3 T A 10: 109,694,035 E2148D probably damaging Het
Nfe2l3 A G 6: 51,456,615 T236A possibly damaging Het
Odc1 T A 12: 17,548,800 F227Y probably benign Het
Olfr1444 T C 19: 12,862,630 M285T possibly damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Pdcd1 T C 1: 94,041,264 I110V probably benign Het
Pde5a G A 3: 122,760,896 E212K probably damaging Het
Plin4 A G 17: 56,106,704 I307T probably benign Het
Rag1 T C 2: 101,643,039 Y586C probably damaging Het
Rgs9 A G 11: 109,275,813 probably benign Het
Rin3 A G 12: 102,390,083 D961G probably damaging Het
Rubcn A G 16: 32,829,259 probably null Het
Slc13a2 T A 11: 78,398,400 Y495F probably damaging Het
Tfec T A 6: 16,845,459 D67V probably damaging Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Tmem94 T C 11: 115,789,254 M30T probably benign Het
Tubgcp6 A G 15: 89,104,414 probably benign Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r85 T C 10: 130,418,467 M783V probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Zfp94 T G 7: 24,303,687 D110A probably benign Het
Other mutations in Rgs7bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02117:Rgs7bp APN 13 104951579 missense possibly damaging 0.92
R0607:Rgs7bp UTSW 13 104967102 missense probably benign 0.02
R1938:Rgs7bp UTSW 13 104951582 missense probably damaging 1.00
R2151:Rgs7bp UTSW 13 104964089 missense probably damaging 1.00
R3933:Rgs7bp UTSW 13 105052998 missense probably benign 0.00
R4686:Rgs7bp UTSW 13 104964089 missense probably damaging 1.00
R4828:Rgs7bp UTSW 13 105053024 missense possibly damaging 0.59
R4944:Rgs7bp UTSW 13 104951564 missense probably benign 0.29
R7181:Rgs7bp UTSW 13 104982874 missense possibly damaging 0.85
R7786:Rgs7bp UTSW 13 105054060 missense probably benign 0.01
R8118:Rgs7bp UTSW 13 105053121 missense probably damaging 1.00
R8190:Rgs7bp UTSW 13 105053109 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTATATGATCTCACCCATCTGAG -3'
(R):5'- CCCAGAAGTCAGTGAAATCTCTG -3'

Sequencing Primer
(F):5'- TCTCACCCATCTGAGAATGATCGG -3'
(R):5'- CAGCTTGTCCAAGAGTTC -3'
Posted On2015-04-17