Incidental Mutation 'R3932:Rubcn'
ID308527
Institutional Source Beutler Lab
Gene Symbol Rubcn
Ensembl Gene ENSMUSG00000035629
Gene NameRUN domain and cysteine-rich domain containing, Beclin 1-interacting protein
Synonyms1700021K19Rik
MMRRC Submission 040919-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R3932 (G1)
Quality Score176
Status Validated
Chromosome16
Chromosomal Location32821703-32877766 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 32829259 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040986] [ENSMUST00000089684] [ENSMUST00000115105] [ENSMUST00000115105] [ENSMUST00000119810] [ENSMUST00000119810] [ENSMUST00000231478] [ENSMUST00000232269]
Predicted Effect probably null
Transcript: ENSMUST00000040986
SMART Domains Protein: ENSMUSP00000048811
Gene: ENSMUSG00000035629

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
RUN 123 183 1.67e-15 SMART
low complexity region 230 254 N/A INTRINSIC
low complexity region 339 371 N/A INTRINSIC
Blast:DUF4206 469 687 1e-66 BLAST
DUF4206 706 908 1.66e-113 SMART
low complexity region 915 941 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000089684
SMART Domains Protein: ENSMUSP00000087114
Gene: ENSMUSG00000035629

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
RUN 123 183 1.67e-15 SMART
low complexity region 230 254 N/A INTRINSIC
low complexity region 339 371 N/A INTRINSIC
Blast:DUF4206 484 702 1e-66 BLAST
DUF4206 721 923 1.66e-113 SMART
low complexity region 930 956 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115105
SMART Domains Protein: ENSMUSP00000110757
Gene: ENSMUSG00000035629

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
RUN 123 183 1.67e-15 SMART
low complexity region 230 254 N/A INTRINSIC
low complexity region 340 357 N/A INTRINSIC
Blast:DUF4206 455 673 1e-66 BLAST
DUF4206 692 894 1.66e-113 SMART
low complexity region 901 927 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115105
SMART Domains Protein: ENSMUSP00000110757
Gene: ENSMUSG00000035629

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
RUN 123 183 1.67e-15 SMART
low complexity region 230 254 N/A INTRINSIC
low complexity region 340 357 N/A INTRINSIC
Blast:DUF4206 455 673 1e-66 BLAST
DUF4206 692 894 1.66e-113 SMART
low complexity region 901 927 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119810
SMART Domains Protein: ENSMUSP00000113087
Gene: ENSMUSG00000035629

DomainStartEndE-ValueType
RUN 62 122 1.67e-15 SMART
low complexity region 169 193 N/A INTRINSIC
low complexity region 278 310 N/A INTRINSIC
Blast:DUF4206 408 626 6e-67 BLAST
DUF4206 645 847 1.66e-113 SMART
low complexity region 854 880 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119810
SMART Domains Protein: ENSMUSP00000113087
Gene: ENSMUSG00000035629

DomainStartEndE-ValueType
RUN 62 122 1.67e-15 SMART
low complexity region 169 193 N/A INTRINSIC
low complexity region 278 310 N/A INTRINSIC
Blast:DUF4206 408 626 6e-67 BLAST
DUF4206 645 847 1.66e-113 SMART
low complexity region 854 880 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152920
Predicted Effect probably null
Transcript: ENSMUST00000231478
Predicted Effect probably null
Transcript: ENSMUST00000232269
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a negative regulator of autophagy and endocytic trafficking and controls endosome maturation. This protein contains two conserved domains, an N-terminal RUN domain and a C-terminal DUF4206 domain. The RUN domain is involved in Ras-like GTPase signaling, and the DUF4206 domain contains a diacylglycerol (DAG) binding-like motif. Mutation in this gene results in deletion of the DAG binding-like motif and causes a recessive ataxia. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b2 C T 7: 81,473,850 probably benign Het
Arl1 C T 10: 88,733,536 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp10a T C 7: 58,827,104 M1189T possibly damaging Het
BC051142 A G 17: 34,443,443 T86A possibly damaging Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
Cdc34b G A 11: 94,742,615 V214M probably benign Het
Cfap54 T C 10: 92,829,757 T2985A probably benign Het
Clcc1 T C 3: 108,673,366 M332T probably damaging Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ctdnep1 A G 11: 69,989,574 probably benign Het
Edar C T 10: 58,610,342 C221Y probably damaging Het
Fam135b T A 15: 71,450,431 Q1295L probably benign Het
Fam184a C T 10: 53,699,301 A71T probably damaging Het
Fbxw10 A G 11: 62,869,157 probably benign Het
Frmd4a T C 2: 4,537,260 W247R probably damaging Het
Gcn1l1 A G 5: 115,587,834 H553R probably benign Het
Grin3a C T 4: 49,672,472 probably null Het
H2-Q6 C T 17: 35,425,566 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Med10 A G 13: 69,809,982 N18D probably damaging Het
Mgat4b T A 11: 50,233,338 H368Q possibly damaging Het
Morn5 C A 2: 36,053,023 T45N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Myrf T C 19: 10,218,151 T432A probably damaging Het
Nav3 T A 10: 109,694,035 E2148D probably damaging Het
Nfe2l3 A G 6: 51,456,615 T236A possibly damaging Het
Odc1 T A 12: 17,548,800 F227Y probably benign Het
Olfr1444 T C 19: 12,862,630 M285T possibly damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Pdcd1 T C 1: 94,041,264 I110V probably benign Het
Pde5a G A 3: 122,760,896 E212K probably damaging Het
Plin4 A G 17: 56,106,704 I307T probably benign Het
Rag1 T C 2: 101,643,039 Y586C probably damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rgs9 A G 11: 109,275,813 probably benign Het
Rin3 A G 12: 102,390,083 D961G probably damaging Het
Slc13a2 T A 11: 78,398,400 Y495F probably damaging Het
Tfec T A 6: 16,845,459 D67V probably damaging Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Tmem94 T C 11: 115,789,254 M30T probably benign Het
Tubgcp6 A G 15: 89,104,414 probably benign Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r85 T C 10: 130,418,467 M783V probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Zfp94 T G 7: 24,303,687 D110A probably benign Het
Other mutations in Rubcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Rubcn APN 16 32824377 critical splice donor site probably null
IGL00777:Rubcn APN 16 32836563 missense probably damaging 0.98
IGL01402:Rubcn APN 16 32827296 missense probably damaging 1.00
IGL01404:Rubcn APN 16 32827296 missense probably damaging 1.00
IGL02255:Rubcn APN 16 32827345 missense probably benign 0.04
IGL03019:Rubcn APN 16 32826707 missense probably damaging 0.98
IGL03388:Rubcn APN 16 32841568 missense probably benign 0.02
R0254:Rubcn UTSW 16 32847946 missense probably benign 0.00
R0373:Rubcn UTSW 16 32835980 missense probably damaging 1.00
R0636:Rubcn UTSW 16 32828686 missense probably damaging 1.00
R0839:Rubcn UTSW 16 32827343 missense probably damaging 0.98
R0967:Rubcn UTSW 16 32825717 missense probably benign 0.00
R1711:Rubcn UTSW 16 32843101 missense probably damaging 1.00
R1819:Rubcn UTSW 16 32826914 missense possibly damaging 0.93
R1840:Rubcn UTSW 16 32826172 missense possibly damaging 0.83
R2511:Rubcn UTSW 16 32847254 missense probably damaging 1.00
R3933:Rubcn UTSW 16 32829259 splice site probably null
R4384:Rubcn UTSW 16 32856902 missense probably damaging 0.96
R4788:Rubcn UTSW 16 32836408 critical splice donor site probably null
R4852:Rubcn UTSW 16 32843308 missense probably damaging 1.00
R4921:Rubcn UTSW 16 32847294 missense probably damaging 1.00
R4950:Rubcn UTSW 16 32843193 missense probably damaging 1.00
R5234:Rubcn UTSW 16 32836458 missense probably damaging 1.00
R5527:Rubcn UTSW 16 32826711 missense probably damaging 1.00
R5616:Rubcn UTSW 16 32826923 missense possibly damaging 0.76
R5823:Rubcn UTSW 16 32849721 missense probably damaging 0.98
R6970:Rubcn UTSW 16 32868144 intron probably benign
R7120:Rubcn UTSW 16 32836469 missense probably damaging 1.00
R7121:Rubcn UTSW 16 32836469 missense probably damaging 1.00
R7221:Rubcn UTSW 16 32866923 intron probably null
R7833:Rubcn UTSW 16 32868274 start gained probably benign
X0065:Rubcn UTSW 16 32847985 missense possibly damaging 0.85
Z1176:Rubcn UTSW 16 32843163 missense probably benign 0.00
Z1177:Rubcn UTSW 16 32825589 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACTTAAGATGGGCACTCGGC -3'
(R):5'- TGCATGGAATGTAGCACCTAG -3'

Sequencing Primer
(F):5'- TGGTGAAACTGCCATTGTACC -3'
(R):5'- CTAGCGGCCACCCCATC -3'
Posted On2015-04-17