Incidental Mutation 'R3932:Olfr1444'
ID308533
Institutional Source Beutler Lab
Gene Symbol Olfr1444
Ensembl Gene ENSMUSG00000046272
Gene Nameolfactory receptor 1444
SynonymsMOR202-4, GA_x6K02T2RE5P-3191201-3192160
MMRRC Submission 040919-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R3932 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12857283-12863440 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12862630 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 285 (M285T)
Ref Sequence ENSEMBL: ENSMUSP00000150212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059675] [ENSMUST00000213606]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059675
AA Change: M285T

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000062460
Gene: ENSMUSG00000046272
AA Change: M285T

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 1.6e-54 PFAM
Pfam:7tm_1 42 291 5.3e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213606
AA Change: M285T

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Meta Mutation Damage Score 0.3264 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b2 C T 7: 81,473,850 probably benign Het
Arl1 C T 10: 88,733,536 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp10a T C 7: 58,827,104 M1189T possibly damaging Het
BC051142 A G 17: 34,443,443 T86A possibly damaging Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
Cdc34b G A 11: 94,742,615 V214M probably benign Het
Cfap54 T C 10: 92,829,757 T2985A probably benign Het
Clcc1 T C 3: 108,673,366 M332T probably damaging Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ctdnep1 A G 11: 69,989,574 probably benign Het
Edar C T 10: 58,610,342 C221Y probably damaging Het
Fam135b T A 15: 71,450,431 Q1295L probably benign Het
Fam184a C T 10: 53,699,301 A71T probably damaging Het
Fbxw10 A G 11: 62,869,157 probably benign Het
Frmd4a T C 2: 4,537,260 W247R probably damaging Het
Gcn1l1 A G 5: 115,587,834 H553R probably benign Het
Grin3a C T 4: 49,672,472 probably null Het
H2-Q6 C T 17: 35,425,566 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Med10 A G 13: 69,809,982 N18D probably damaging Het
Mgat4b T A 11: 50,233,338 H368Q possibly damaging Het
Morn5 C A 2: 36,053,023 T45N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Myrf T C 19: 10,218,151 T432A probably damaging Het
Nav3 T A 10: 109,694,035 E2148D probably damaging Het
Nfe2l3 A G 6: 51,456,615 T236A possibly damaging Het
Odc1 T A 12: 17,548,800 F227Y probably benign Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Pdcd1 T C 1: 94,041,264 I110V probably benign Het
Pde5a G A 3: 122,760,896 E212K probably damaging Het
Plin4 A G 17: 56,106,704 I307T probably benign Het
Rag1 T C 2: 101,643,039 Y586C probably damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rgs9 A G 11: 109,275,813 probably benign Het
Rin3 A G 12: 102,390,083 D961G probably damaging Het
Rubcn A G 16: 32,829,259 probably null Het
Slc13a2 T A 11: 78,398,400 Y495F probably damaging Het
Tfec T A 6: 16,845,459 D67V probably damaging Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Tmem94 T C 11: 115,789,254 M30T probably benign Het
Tubgcp6 A G 15: 89,104,414 probably benign Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r85 T C 10: 130,418,467 M783V probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Zfp94 T G 7: 24,303,687 D110A probably benign Het
Other mutations in Olfr1444
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:Olfr1444 APN 19 12861867 missense probably benign 0.00
IGL01963:Olfr1444 APN 19 12862382 missense probably benign 0.00
IGL02030:Olfr1444 APN 19 12862435 missense probably benign 0.00
IGL02178:Olfr1444 APN 19 12862543 missense possibly damaging 0.49
IGL02641:Olfr1444 APN 19 12862202 nonsense probably null
R0311:Olfr1444 UTSW 19 12861869 missense probably benign 0.01
R0543:Olfr1444 UTSW 19 12861888 missense probably benign 0.00
R0815:Olfr1444 UTSW 19 12862644 missense probably benign 0.00
R2034:Olfr1444 UTSW 19 12861787 missense possibly damaging 0.82
R2078:Olfr1444 UTSW 19 12862387 missense probably benign 0.05
R2431:Olfr1444 UTSW 19 12862606 missense probably damaging 1.00
R3032:Olfr1444 UTSW 19 12861918 missense probably benign 0.00
R4498:Olfr1444 UTSW 19 12862669 missense probably damaging 1.00
R4654:Olfr1444 UTSW 19 12862232 nonsense probably null
R4708:Olfr1444 UTSW 19 12861897 missense probably benign 0.00
R4823:Olfr1444 UTSW 19 12861816 missense probably benign 0.04
R4938:Olfr1444 UTSW 19 12862552 missense probably damaging 1.00
R4980:Olfr1444 UTSW 19 12862020 missense probably benign
R5580:Olfr1444 UTSW 19 12861804 missense possibly damaging 0.59
R5622:Olfr1444 UTSW 19 12862299 missense probably benign 0.08
R5671:Olfr1444 UTSW 19 12861807 missense probably benign 0.02
R6149:Olfr1444 UTSW 19 12862359 missense probably benign 0.02
R6683:Olfr1444 UTSW 19 12862650 missense probably damaging 0.98
R7389:Olfr1444 UTSW 19 12862617 missense probably benign 0.04
R7392:Olfr1444 UTSW 19 12862587 missense probably benign 0.18
R7461:Olfr1444 UTSW 19 12861777 start codon destroyed probably benign 0.00
R7613:Olfr1444 UTSW 19 12861777 start codon destroyed probably benign 0.00
R7698:Olfr1444 UTSW 19 12862713 missense possibly damaging 0.69
R7717:Olfr1444 UTSW 19 12861795 missense probably benign 0.07
R7892:Olfr1444 UTSW 19 12862479 nonsense probably null
Z1088:Olfr1444 UTSW 19 12862284 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGAAGTCTTCTGAGGGACG -3'
(R):5'- AAGTCGTCATCTTCCAGAAGG -3'

Sequencing Primer
(F):5'- TCTTCTGAGGGACGAAAGAAGGC -3'
(R):5'- GGAACTGAAATGCCCACTATTCTTGG -3'
Posted On2015-04-17