Incidental Mutation 'R3932:Tmem28'
ID308534
Institutional Source Beutler Lab
Gene Symbol Tmem28
Ensembl Gene ENSMUSG00000071719
Gene Nametransmembrane protein 28
SynonymsEG620592, Fam155b
MMRRC Submission 040919-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R3932 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location99821021-99848790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99821864 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 266 (V266M)
Ref Sequence ENSEMBL: ENSMUSP00000094090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096363]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096363
AA Change: V266M

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000094090
Gene: ENSMUSG00000071719
AA Change: V266M

DomainStartEndE-ValueType
low complexity region 90 112 N/A INTRINSIC
low complexity region 159 176 N/A INTRINSIC
low complexity region 381 401 N/A INTRINSIC
low complexity region 432 444 N/A INTRINSIC
low complexity region 447 457 N/A INTRINSIC
Meta Mutation Damage Score 0.0940 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a product belonging to a family of proteins with unknown function. The presence of two transmembrane domains suggests that this protein is a multi-pass membrane protein. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b2 C T 7: 81,473,850 probably benign Het
Arl1 C T 10: 88,733,536 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp10a T C 7: 58,827,104 M1189T possibly damaging Het
BC051142 A G 17: 34,443,443 T86A possibly damaging Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
Cdc34b G A 11: 94,742,615 V214M probably benign Het
Cfap54 T C 10: 92,829,757 T2985A probably benign Het
Clcc1 T C 3: 108,673,366 M332T probably damaging Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ctdnep1 A G 11: 69,989,574 probably benign Het
Edar C T 10: 58,610,342 C221Y probably damaging Het
Fam135b T A 15: 71,450,431 Q1295L probably benign Het
Fam184a C T 10: 53,699,301 A71T probably damaging Het
Fbxw10 A G 11: 62,869,157 probably benign Het
Frmd4a T C 2: 4,537,260 W247R probably damaging Het
Gcn1l1 A G 5: 115,587,834 H553R probably benign Het
Grin3a C T 4: 49,672,472 probably null Het
H2-Q6 C T 17: 35,425,566 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Med10 A G 13: 69,809,982 N18D probably damaging Het
Mgat4b T A 11: 50,233,338 H368Q possibly damaging Het
Morn5 C A 2: 36,053,023 T45N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Myrf T C 19: 10,218,151 T432A probably damaging Het
Nav3 T A 10: 109,694,035 E2148D probably damaging Het
Nfe2l3 A G 6: 51,456,615 T236A possibly damaging Het
Odc1 T A 12: 17,548,800 F227Y probably benign Het
Olfr1444 T C 19: 12,862,630 M285T possibly damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Pdcd1 T C 1: 94,041,264 I110V probably benign Het
Pde5a G A 3: 122,760,896 E212K probably damaging Het
Plin4 A G 17: 56,106,704 I307T probably benign Het
Rag1 T C 2: 101,643,039 Y586C probably damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rgs9 A G 11: 109,275,813 probably benign Het
Rin3 A G 12: 102,390,083 D961G probably damaging Het
Rubcn A G 16: 32,829,259 probably null Het
Slc13a2 T A 11: 78,398,400 Y495F probably damaging Het
Tfec T A 6: 16,845,459 D67V probably damaging Het
Tmem94 T C 11: 115,789,254 M30T probably benign Het
Tubgcp6 A G 15: 89,104,414 probably benign Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r85 T C 10: 130,418,467 M783V probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Zfp94 T G 7: 24,303,687 D110A probably benign Het
Other mutations in Tmem28
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3405:Tmem28 UTSW X 99845503 missense probably benign 0.02
R3406:Tmem28 UTSW X 99845503 missense probably benign 0.02
R3933:Tmem28 UTSW X 99821864 missense possibly damaging 0.94
RF011:Tmem28 UTSW X 99821361 small insertion probably benign
RF017:Tmem28 UTSW X 99821365 small insertion probably benign
RF018:Tmem28 UTSW X 99821361 small insertion probably benign
RF033:Tmem28 UTSW X 99821373 small insertion probably benign
RF039:Tmem28 UTSW X 99821372 small insertion probably benign
RF051:Tmem28 UTSW X 99821362 small insertion probably benign
X0033:Tmem28 UTSW X 99821121 small deletion probably benign
X0036:Tmem28 UTSW X 99821121 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TTGCGACACCTACACAGTCTG -3'
(R):5'- TACTACACTGGGAATGGTGGG -3'

Sequencing Primer
(F):5'- ACCTACACAGTCTGGGACTTG -3'
(R):5'- CTGGGAATGGTGGGAGCCG -3'
Posted On2015-04-17