Mutagenetix > Incidental Mutations

Incidental Mutation 'R3933:Itga8'

308539

Institutional Source

Beutler Lab

Gene Symbol

Itga8

Ensembl Gene

ENSMUSG00000026768

Gene Name

integrin alpha 8

Synonyms

MMRRC Submission

040920-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.805) question?

Stock #

R3933 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12106632-12301922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12189519 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 690 (I690T)

Ref Sequence

ENSEMBL: ENSMUSP00000028106 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]

Predicted Effect

probably benign
Transcript: ENSMUST00000028106
AA Change: I690T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: I690T

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART
SCOP:d1m1xa2	643	780	2e-46	SMART
SCOP:d1m1xa3	784	1000	2e-80	SMART
transmembrane domain	1011	1033	N/A	INTRINSIC
Pfam:Integrin_alpha	1034	1048	2.5e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129370

Predicted Effect

probably benign
Transcript: ENSMUST00000172791

SMART Domains

Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.1%
20x: 94.1%

Validation Efficiency

96% (43/45)

MGI Phenotype

FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,354,856	F3350L	probably damaging	Het
Acp6	T	C	3: 97,166,183	V146A	probably benign	Het
Ap3b2	C	T	7: 81,473,850		probably benign	Het
Arhgef33	A	G	17: 80,373,320	I630V	probably benign	Het
Astn2	G	A	4: 66,403,955	R136C	unknown	Het
Bcl2l14	A	G	6: 134,423,808	D64G	probably damaging	Het
C1rl	T	A	6: 124,508,822	L384*	probably null	Het
Ccdc130	G	A	8: 84,260,352	A172V	probably benign	Het
Ccdc6	TCCGCCGCCGCC	TCCGCCGCC	10: 70,189,170		probably benign	Het
Coch	T	C	12: 51,603,338	I370T	probably damaging	Het
Ercc5	T	A	1: 44,167,856	M643K	probably benign	Het
Fut8	A	C	12: 77,475,259	K557N	probably damaging	Het
Hsdl2	T	C	4: 59,597,274	Y88H	probably damaging	Het
Hspg2	T	C	4: 137,515,568	V670A	probably damaging	Het
Lepr	T	C	4: 101,765,301		probably benign	Het
Matn2	T	C	15: 34,345,420		probably null	Het
Mei1	A	G	15: 82,083,152	K310E	possibly damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Msl3	C	T	X: 168,671,817	A87T	probably damaging	Het
Ogdh	T	C	11: 6,342,601	V438A	possibly damaging	Het
Olfr1109	T	A	2: 87,092,762	I212F	probably benign	Het
Olfr1293-ps	T	C	2: 111,527,955	Y232H	probably damaging	Het
Opa1	A	T	16: 29,610,880	E401D	probably damaging	Het
Parp2	G	A	14: 50,819,387	V323M	probably benign	Het
Pip5k1a	A	G	3: 95,072,003	S161P	probably benign	Het
Pold3	T	C	7: 100,121,401	E8G	probably damaging	Het
Pomt1	G	A	2: 32,245,619	V332I	probably benign	Het
Ppp2ca	T	A	11: 52,119,262	N232K	probably damaging	Het
Prune2	A	T	19: 17,123,954	D2274V	probably damaging	Het
Pwwp2b	G	A	7: 139,256,034	V464I	possibly damaging	Het
Rgs7bp	T	C	13: 105,052,998	M98V	probably benign	Het
Rubcn	A	G	16: 32,829,259		probably null	Het
Scai	A	T	2: 39,075,052	D593E	probably benign	Het
Slc24a2	T	C	4: 87,176,185	T366A	probably benign	Het
Sp100	A	G	1: 85,681,109	I320V	probably benign	Het
Syngr2	C	A	11: 117,813,417	P206Q	probably damaging	Het
Tatdn3	A	T	1: 191,046,324		probably null	Het
Thsd7a	C	T	6: 12,555,226	G220S	probably benign	Het
Tmem28	G	A	X: 99,821,864	V266M	possibly damaging	Het
Vmn2r10	C	A	5: 109,002,222	A319S	possibly damaging	Het
Vmn2r11	C	T	5: 109,053,394	A415T	probably damaging	Het
Vmn2r88	A	G	14: 51,413,978	M258V	probably benign	Het
Wiz	G	A	17: 32,357,898	R561C	probably damaging	Het
Zfp422	T	C	6: 116,626,459	K193R	probably benign	Het

Other mutations in Itga8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00806:Itga8	APN	2	12255966	nonsense	probably null
IGL00820:Itga8	APN	2	12232892	missense	possibly damaging	0.85
IGL01409:Itga8	APN	2	12191714	missense	probably benign
IGL01508:Itga8	APN	2	12232802	missense	possibly damaging	0.67
IGL01585:Itga8	APN	2	12160312	splice site	probably benign
IGL01590:Itga8	APN	2	12160333	missense	probably damaging	1.00
IGL01743:Itga8	APN	2	12265333	missense	probably benign	0.04
IGL02634:Itga8	APN	2	12140478	missense	possibly damaging	0.55
IGL02805:Itga8	APN	2	12189480	missense	possibly damaging	0.83
IGL03200:Itga8	APN	2	12191199	missense	probably benign	0.00
IGL03218:Itga8	APN	2	12111025	missense	possibly damaging	0.77
IGL03248:Itga8	APN	2	12132516	missense	probably benign	0.20
PIT4576001:Itga8	UTSW	2	12230092	missense	probably benign	0.19
R0196:Itga8	UTSW	2	12204729	critical splice donor site	probably null
R0356:Itga8	UTSW	2	12182721	missense	possibly damaging	0.73
R0466:Itga8	UTSW	2	12232886	missense	probably damaging	1.00
R0530:Itga8	UTSW	2	12191816	missense	probably damaging	0.99
R0715:Itga8	UTSW	2	12191242	splice site	probably benign
R0800:Itga8	UTSW	2	12193551	missense	possibly damaging	0.95
R0881:Itga8	UTSW	2	12262192	splice site	probably null
R1675:Itga8	UTSW	2	12200163	missense	probably damaging	0.99
R1758:Itga8	UTSW	2	12265333	missense	possibly damaging	0.83
R1939:Itga8	UTSW	2	12300846	missense	probably damaging	1.00
R2187:Itga8	UTSW	2	12194420	missense	possibly damaging	0.60
R2295:Itga8	UTSW	2	12182709	missense	probably benign	0.38
R2356:Itga8	UTSW	2	12200141	missense	probably benign
R2371:Itga8	UTSW	2	12253466	missense	probably damaging	1.00
R2412:Itga8	UTSW	2	12301715	missense	probably benign
R2440:Itga8	UTSW	2	12178680	missense	possibly damaging	0.70
R2848:Itga8	UTSW	2	12160404	missense	probably damaging	0.98
R3730:Itga8	UTSW	2	12193510	missense	possibly damaging	0.92
R3982:Itga8	UTSW	2	12300963	missense	possibly damaging	0.92
R4513:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4514:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4660:Itga8	UTSW	2	12265258	missense	probably damaging	1.00
R4890:Itga8	UTSW	2	12193291	splice site	probably benign
R5533:Itga8	UTSW	2	12160350	missense	possibly damaging	0.90
R5619:Itga8	UTSW	2	12265328	missense	probably damaging	1.00
R5720:Itga8	UTSW	2	12111087	missense	probably damaging	0.99
R5749:Itga8	UTSW	2	12262078	missense	probably damaging	1.00
R5930:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R5954:Itga8	UTSW	2	12132486	missense	probably damaging	0.99
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6211:Itga8	UTSW	2	12193509	missense	probably damaging	1.00
R6337:Itga8	UTSW	2	12253469	nonsense	probably null
R6442:Itga8	UTSW	2	12230143	missense	probably benign	0.00
R6491:Itga8	UTSW	2	12204776	missense	probably damaging	1.00
R6543:Itga8	UTSW	2	12301644	missense	probably damaging	0.99
R6574:Itga8	UTSW	2	12230161	missense	probably benign	0.17
R6760:Itga8	UTSW	2	12301640	missense	probably damaging	1.00
R6858:Itga8	UTSW	2	12200081	missense	probably benign	0.00
R6943:Itga8	UTSW	2	12155371	critical splice donor site	probably null
R7048:Itga8	UTSW	2	12111084	missense	probably damaging	0.99
R7203:Itga8	UTSW	2	12230095	missense	possibly damaging	0.77
R7266:Itga8	UTSW	2	12232901	missense	probably damaging	1.00
R7323:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R7540:Itga8	UTSW	2	12111037	missense	possibly damaging	0.82
R7637:Itga8	UTSW	2	12109187	missense	probably damaging	1.00
R7748:Itga8	UTSW	2	12230239	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- GGCCATCTTTGTACTGTGCC -3'
(R):5'- CTAAATCACTGTATTTCTTGGTCGG -3'

Sequencing Primer
(F):5'- ACTGTGCCTGAGAGAGACTTTAC -3'
(R):5'- TGAGACAGACTCCTGCTATGTAGC -3'

Posted On

2015-04-17