Incidental Mutation 'R0379:Chd5'
ID30854
Institutional Source Beutler Lab
Gene Symbol Chd5
Ensembl Gene ENSMUSG00000005045
Gene Namechromodomain helicase DNA binding protein 5
Synonyms
MMRRC Submission 038585-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0379 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location152338651-152390194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152383321 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 1692 (K1692R)
Ref Sequence ENSEMBL: ENSMUSP00000132600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005175] [ENSMUST00000030775] [ENSMUST00000164662]
Predicted Effect probably benign
Transcript: ENSMUST00000005175
AA Change: K1729R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000005175
Gene: ENSMUSG00000005045
AA Change: K1729R

DomainStartEndE-ValueType
low complexity region 17 40 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
Pfam:CHDNT 149 203 2e-32 PFAM
low complexity region 209 220 N/A INTRINSIC
low complexity region 256 273 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
PHD 347 390 1.09e-14 SMART
RING 348 389 4.48e-1 SMART
low complexity region 400 416 N/A INTRINSIC
PHD 420 463 3.29e-14 SMART
RING 421 462 4.15e0 SMART
CHROMO 468 548 2.52e-13 SMART
CHROMO 592 649 1.34e-8 SMART
low complexity region 657 678 N/A INTRINSIC
DEXDc 698 910 8.34e-33 SMART
low complexity region 1023 1038 N/A INTRINSIC
HELICc 1056 1140 4.02e-26 SMART
DUF1087 1297 1361 2.78e-33 SMART
DUF1086 1374 1533 5.11e-105 SMART
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1685 1701 N/A INTRINSIC
Pfam:CHDCT2 1729 1901 1.7e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030775
AA Change: K1729R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000030775
Gene: ENSMUSG00000005045
AA Change: K1729R

DomainStartEndE-ValueType
low complexity region 17 40 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
Pfam:CHDNT 150 203 9e-28 PFAM
low complexity region 209 220 N/A INTRINSIC
low complexity region 256 273 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
PHD 347 390 1.09e-14 SMART
RING 348 389 4.48e-1 SMART
low complexity region 400 416 N/A INTRINSIC
PHD 420 463 3.29e-14 SMART
RING 421 462 4.15e0 SMART
CHROMO 468 548 2.52e-13 SMART
CHROMO 592 649 1.34e-8 SMART
low complexity region 657 678 N/A INTRINSIC
DEXDc 698 910 8.34e-33 SMART
low complexity region 1023 1038 N/A INTRINSIC
HELICc 1056 1140 4.02e-26 SMART
DUF1087 1297 1361 2.78e-33 SMART
DUF1086 1374 1533 5.11e-105 SMART
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1685 1701 N/A INTRINSIC
Pfam:CHDCT2 1730 1901 2.8e-93 PFAM
low complexity region 1922 1936 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124423
Predicted Effect probably benign
Transcript: ENSMUST00000164662
AA Change: K1692R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000132600
Gene: ENSMUSG00000005045
AA Change: K1692R

DomainStartEndE-ValueType
low complexity region 17 40 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
Pfam:CHDNT 149 203 1.9e-32 PFAM
low complexity region 209 220 N/A INTRINSIC
low complexity region 256 273 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
PHD 347 390 1.09e-14 SMART
RING 348 389 4.48e-1 SMART
low complexity region 400 416 N/A INTRINSIC
PHD 420 463 3.29e-14 SMART
RING 421 462 4.15e0 SMART
CHROMO 468 548 2.52e-13 SMART
CHROMO 592 649 1.34e-8 SMART
low complexity region 657 678 N/A INTRINSIC
DEXDc 698 910 8.34e-33 SMART
low complexity region 1023 1038 N/A INTRINSIC
HELICc 1056 1140 4.02e-26 SMART
DUF1087 1260 1324 2.78e-33 SMART
DUF1086 1337 1496 5.11e-105 SMART
low complexity region 1515 1530 N/A INTRINSIC
low complexity region 1648 1664 N/A INTRINSIC
Pfam:CHDCT2 1692 1864 1.7e-99 PFAM
low complexity region 1885 1899 N/A INTRINSIC
Meta Mutation Damage Score 0.0841 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chromodomain helicase DNA-binding protein family. Members of this family are characterized by a chromodomain, a helicase ATP-binding domain and an additional functional domain. This gene encodes a neuron-specific protein that may function in chromatin remodeling and gene transcription. This gene is a potential tumor suppressor gene that may play a role in the development of neuroblastoma. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility with abnormal spermiogenesis and chromatin condensation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,785,546 probably benign Het
4930512M02Rik A G 11: 11,589,365 probably benign Het
Apba1 A C 19: 23,934,830 N558T probably damaging Het
Arfgef2 T A 2: 166,860,400 probably null Het
Arsb T C 13: 93,940,627 S501P probably benign Het
Atp10b A G 11: 43,254,314 T1295A probably benign Het
Atp8b5 G T 4: 43,361,898 R648L probably damaging Het
Bcl2a1b T C 9: 89,199,736 I126T possibly damaging Het
Brd9 T C 13: 73,942,683 probably benign Het
Cd93 T C 2: 148,441,510 probably benign Het
Clcn4 T C 7: 7,296,792 T13A probably damaging Het
Clec14a A G 12: 58,268,794 F14S possibly damaging Het
Clec4g A G 8: 3,718,440 V97A probably benign Het
Col24a1 G A 3: 145,524,142 R1483K possibly damaging Het
Crem A T 18: 3,299,226 V82D probably damaging Het
Ctnna2 T A 6: 77,641,440 T180S probably benign Het
Cybrd1 T C 2: 71,129,755 I99T probably benign Het
Cyp4a32 G A 4: 115,621,474 V468M probably damaging Het
Dlk1 A G 12: 109,455,059 probably benign Het
Dnah7b A T 1: 46,140,176 Y1003F probably benign Het
Egfem1 A C 3: 29,668,250 E376A possibly damaging Het
Etl4 T A 2: 20,807,354 I1416K probably damaging Het
Fbxl4 A G 4: 22,386,106 T238A probably benign Het
Fer1l6 A G 15: 58,548,338 I33M probably benign Het
Fndc3a A G 14: 72,556,609 S830P probably damaging Het
Fras1 C T 5: 96,755,509 R3082* probably null Het
Galnt13 T C 2: 55,060,492 V395A possibly damaging Het
Gm10334 T G 6: 41,445,256 probably benign Het
Gpd2 C T 2: 57,345,263 T335I probably damaging Het
Gucy2d C A 7: 98,459,002 probably null Het
Hydin A G 8: 110,509,127 probably benign Het
Ints5 G T 19: 8,897,133 V819L possibly damaging Het
Klhdc10 C G 6: 30,450,670 Q292E possibly damaging Het
Lmbrd2 G A 15: 9,149,479 A67T probably benign Het
Lrp1 T G 10: 127,594,969 T404P probably damaging Het
March7 T C 2: 60,234,126 S249P probably benign Het
Mcm10 T A 2: 5,008,623 K66M probably benign Het
Mtmr7 C A 8: 40,551,601 D645Y probably damaging Het
Muc6 T A 7: 141,636,955 I2602F possibly damaging Het
Myh13 G A 11: 67,369,295 probably benign Het
Myo18a G A 11: 77,850,806 V1776I possibly damaging Het
Ncapg2 T C 12: 116,443,075 L957S probably damaging Het
Ncoa3 T C 2: 166,054,502 S442P probably damaging Het
Olfr1093 G A 2: 86,785,735 E2K probably benign Het
Olfr850 T A 9: 19,477,480 T257S possibly damaging Het
Olfr986 G A 9: 40,187,433 G106D probably damaging Het
Pdcd6 G T 13: 74,309,712 N113K possibly damaging Het
Pfkfb4 C T 9: 109,027,742 probably benign Het
Pfkm A G 15: 98,126,314 H401R probably benign Het
Phldb2 C A 16: 45,781,451 D754Y probably damaging Het
Plekhb2 T A 1: 34,863,114 M49K probably damaging Het
Polrmt A G 10: 79,737,611 S1057P possibly damaging Het
Prps1l1 A G 12: 34,985,078 N64S probably benign Het
Psg16 T C 7: 17,130,658 S393P probably benign Het
Rundc1 C T 11: 101,425,147 T15I probably benign Het
Scaf11 A G 15: 96,431,816 L143S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpinf1 T G 11: 75,413,945 I197L probably benign Het
Siglec1 C T 2: 131,074,525 probably benign Het
Slc28a1 G A 7: 81,138,177 V271I probably benign Het
Sntg1 T C 1: 8,782,824 D34G probably damaging Het
Sptbn4 A T 7: 27,359,736 probably benign Het
Suclg1 T C 6: 73,256,228 I51T possibly damaging Het
Syne1 C T 10: 5,541,989 R9Q probably damaging Het
Trim47 T A 11: 116,106,518 H470L probably damaging Het
Ttc41 T A 10: 86,712,977 Y12N possibly damaging Het
Tubgcp2 T C 7: 140,032,192 E69G probably damaging Het
Tubgcp3 G A 8: 12,641,116 T474M probably damaging Het
Ubr5 A T 15: 38,018,957 N777K probably benign Het
Ush2a T C 1: 188,451,819 L1440P probably damaging Het
Usp28 A C 9: 49,024,067 D458A possibly damaging Het
Vcan A T 13: 89,703,546 D1098E probably damaging Het
Vmn1r73 C T 7: 11,756,846 T197I probably benign Het
Vmn2r15 T C 5: 109,286,478 S787G probably damaging Het
Vmn2r90 T A 17: 17,728,139 I549N probably damaging Het
Vps33b T A 7: 80,283,414 probably null Het
Zfp516 A T 18: 82,987,670 K900* probably null Het
Zfp974 T A 7: 27,910,932 N456I probably damaging Het
Other mutations in Chd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Chd5 APN 4 152360602 missense probably damaging 1.00
IGL00886:Chd5 APN 4 152359699 missense probably benign 0.00
IGL00963:Chd5 APN 4 152382938 missense probably damaging 1.00
IGL01399:Chd5 APN 4 152356687 missense probably damaging 1.00
IGL01571:Chd5 APN 4 152384115 splice site probably benign
IGL01606:Chd5 APN 4 152360975 missense probably damaging 0.99
IGL01636:Chd5 APN 4 152384653 nonsense probably null
IGL02009:Chd5 APN 4 152366213 missense probably damaging 1.00
IGL02417:Chd5 APN 4 152367294 missense probably damaging 0.97
IGL02504:Chd5 APN 4 152363322 missense probably damaging 0.99
IGL02508:Chd5 APN 4 152363024 missense probably damaging 1.00
IGL02597:Chd5 APN 4 152371712 missense probably damaging 1.00
IGL02608:Chd5 APN 4 152356107 missense possibly damaging 0.94
IGL02612:Chd5 APN 4 152360576 missense probably damaging 1.00
IGL02658:Chd5 APN 4 152360593 missense probably damaging 1.00
IGL02662:Chd5 APN 4 152372131 missense probably damaging 1.00
IGL02676:Chd5 APN 4 152356073 splice site probably benign
IGL02871:Chd5 APN 4 152376685 missense probably damaging 1.00
IGL02942:Chd5 APN 4 152385725 missense probably damaging 0.98
IGL02956:Chd5 APN 4 152379956 missense probably benign 0.00
IGL03286:Chd5 APN 4 152385495 missense probably benign 0.00
IGL03348:Chd5 APN 4 152376685 missense probably damaging 1.00
IGL03398:Chd5 APN 4 152377082 missense probably damaging 0.97
PIT1430001:Chd5 UTSW 4 152370637 missense probably damaging 1.00
PIT4151001:Chd5 UTSW 4 152378529 missense probably damaging 0.99
R0079:Chd5 UTSW 4 152385749 missense probably damaging 1.00
R0241:Chd5 UTSW 4 152366132 missense probably damaging 1.00
R0241:Chd5 UTSW 4 152366132 missense probably damaging 1.00
R0388:Chd5 UTSW 4 152371644 missense probably damaging 1.00
R0675:Chd5 UTSW 4 152385950 missense probably benign 0.06
R0730:Chd5 UTSW 4 152347984 missense possibly damaging 0.72
R0799:Chd5 UTSW 4 152384159 missense probably damaging 1.00
R0800:Chd5 UTSW 4 152356157 missense probably damaging 1.00
R1276:Chd5 UTSW 4 152378734 missense probably damaging 1.00
R1752:Chd5 UTSW 4 152375133 missense probably damaging 1.00
R1753:Chd5 UTSW 4 152378815 missense probably damaging 1.00
R1843:Chd5 UTSW 4 152385806 missense probably damaging 1.00
R1850:Chd5 UTSW 4 152370533 missense probably damaging 1.00
R1851:Chd5 UTSW 4 152378270 missense probably damaging 0.97
R1859:Chd5 UTSW 4 152380523 missense probably benign 0.00
R1983:Chd5 UTSW 4 152384666 missense possibly damaging 0.89
R2404:Chd5 UTSW 4 152367334 missense probably damaging 1.00
R2897:Chd5 UTSW 4 152372115 missense probably damaging 1.00
R2898:Chd5 UTSW 4 152372115 missense probably damaging 1.00
R3893:Chd5 UTSW 4 152360656 missense probably damaging 1.00
R3938:Chd5 UTSW 4 152377055 missense probably benign 0.05
R4707:Chd5 UTSW 4 152360582 missense probably damaging 1.00
R4754:Chd5 UTSW 4 152377746 missense probably damaging 0.99
R4911:Chd5 UTSW 4 152360672 missense probably damaging 1.00
R4924:Chd5 UTSW 4 152366429 missense possibly damaging 0.50
R4926:Chd5 UTSW 4 152383311 missense probably benign 0.00
R5256:Chd5 UTSW 4 152372097 missense probably benign 0.01
R5524:Chd5 UTSW 4 152376630 missense probably benign
R5552:Chd5 UTSW 4 152385815 missense possibly damaging 0.95
R5895:Chd5 UTSW 4 152379932 missense probably benign 0.13
R5945:Chd5 UTSW 4 152379951 missense probably benign
R6007:Chd5 UTSW 4 152379421 missense probably null 1.00
R6039:Chd5 UTSW 4 152353621 small deletion probably benign
R6039:Chd5 UTSW 4 152353621 small deletion probably benign
R6172:Chd5 UTSW 4 152379391 missense probably damaging 1.00
R6173:Chd5 UTSW 4 152379391 missense probably damaging 1.00
R6323:Chd5 UTSW 4 152367334 missense probably damaging 0.99
R6331:Chd5 UTSW 4 152382408 missense probably benign 0.02
R6495:Chd5 UTSW 4 152367372 missense probably damaging 1.00
R6528:Chd5 UTSW 4 152356676 missense probably damaging 1.00
R6849:Chd5 UTSW 4 152378538 missense probably damaging 1.00
R6854:Chd5 UTSW 4 152382938 missense probably damaging 1.00
R6859:Chd5 UTSW 4 152378207 missense probably damaging 1.00
R6999:Chd5 UTSW 4 152374434 missense probably damaging 1.00
R7034:Chd5 UTSW 4 152360941 missense possibly damaging 0.89
R7110:Chd5 UTSW 4 152385439 missense probably damaging 1.00
R7361:Chd5 UTSW 4 152363288 missense probably damaging 0.99
R7397:Chd5 UTSW 4 152368012 missense possibly damaging 0.82
R7440:Chd5 UTSW 4 152384651 missense probably benign 0.01
R7489:Chd5 UTSW 4 152373468 missense probably damaging 1.00
R7810:Chd5 UTSW 4 152358575 missense probably damaging 0.97
R8057:Chd5 UTSW 4 152366372 missense probably damaging 1.00
R8078:Chd5 UTSW 4 152360991 missense possibly damaging 0.90
R8092:Chd5 UTSW 4 152378804 missense probably damaging 0.99
R8170:Chd5 UTSW 4 152376583 missense probably benign 0.26
R8255:Chd5 UTSW 4 152379423 missense probably damaging 0.99
R8348:Chd5 UTSW 4 152360716 missense probably damaging 0.98
R8448:Chd5 UTSW 4 152360716 missense probably damaging 0.98
R8478:Chd5 UTSW 4 152356690 nonsense probably null
R8482:Chd5 UTSW 4 152356690 nonsense probably null
Z1176:Chd5 UTSW 4 152378479 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGATGGCGGTTTCACAGGTACAG -3'
(R):5'- AGGTTTTGGGCAGTCACCAGAAG -3'

Sequencing Primer
(F):5'- GATGGTCCATCGTATGCCC -3'
(R):5'- CAGTCACCAGAAGCTGGG -3'
Posted On2013-04-24