Incidental Mutation 'R3933:Scai'
ID308541
Institutional Source Beutler Lab
Gene Symbol Scai
Ensembl Gene ENSMUSG00000035236
Gene Namesuppressor of cancer cell invasion
SynonymsA930041I02Rik
MMRRC Submission 040920-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.605) question?
Stock #R3933 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location39066214-39190734 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39075052 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 593 (D593E)
Ref Sequence ENSEMBL: ENSMUSP00000037194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038874] [ENSMUST00000147433] [ENSMUST00000204093] [ENSMUST00000204404] [ENSMUST00000204500]
Predicted Effect probably benign
Transcript: ENSMUST00000038874
AA Change: D593E

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000037194
Gene: ENSMUSG00000035236
AA Change: D593E

DomainStartEndE-ValueType
Pfam:DUF3550 64 557 6.1e-216 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147433
Predicted Effect probably benign
Transcript: ENSMUST00000204093
SMART Domains Protein: ENSMUSP00000145133
Gene: ENSMUSG00000035236

DomainStartEndE-ValueType
Pfam:DUF3550 64 480 2.5e-177 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204404
Predicted Effect probably benign
Transcript: ENSMUST00000204500
SMART Domains Protein: ENSMUSP00000144844
Gene: ENSMUSG00000035236

DomainStartEndE-ValueType
Pfam:DUF3550 1 77 3.2e-23 PFAM
Meta Mutation Damage Score 0.1042 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of cell migration. The encoded protein appears to function in the RhoA (ras homolog gene family, member A)-Dia1 (diaphanous homolog 1) signal transduction pathway. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous mice of both sexes are sub-fertile owing to compromised meiotic synapsis and homologous recombination-mediated double-strand break DNA repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,354,856 F3350L probably damaging Het
Acp6 T C 3: 97,166,183 V146A probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Arhgef33 A G 17: 80,373,320 I630V probably benign Het
Astn2 G A 4: 66,403,955 R136C unknown Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
C1rl T A 6: 124,508,822 L384* probably null Het
Ccdc130 G A 8: 84,260,352 A172V probably benign Het
Ccdc6 TCCGCCGCCGCC TCCGCCGCC 10: 70,189,170 probably benign Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ercc5 T A 1: 44,167,856 M643K probably benign Het
Fut8 A C 12: 77,475,259 K557N probably damaging Het
Hsdl2 T C 4: 59,597,274 Y88H probably damaging Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Itga8 A G 2: 12,189,519 I690T probably benign Het
Lepr T C 4: 101,765,301 probably benign Het
Matn2 T C 15: 34,345,420 probably null Het
Mei1 A G 15: 82,083,152 K310E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Ogdh T C 11: 6,342,601 V438A possibly damaging Het
Olfr1109 T A 2: 87,092,762 I212F probably benign Het
Olfr1293-ps T C 2: 111,527,955 Y232H probably damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Parp2 G A 14: 50,819,387 V323M probably benign Het
Pip5k1a A G 3: 95,072,003 S161P probably benign Het
Pold3 T C 7: 100,121,401 E8G probably damaging Het
Pomt1 G A 2: 32,245,619 V332I probably benign Het
Ppp2ca T A 11: 52,119,262 N232K probably damaging Het
Prune2 A T 19: 17,123,954 D2274V probably damaging Het
Pwwp2b G A 7: 139,256,034 V464I possibly damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rubcn A G 16: 32,829,259 probably null Het
Slc24a2 T C 4: 87,176,185 T366A probably benign Het
Sp100 A G 1: 85,681,109 I320V probably benign Het
Syngr2 C A 11: 117,813,417 P206Q probably damaging Het
Tatdn3 A T 1: 191,046,324 probably null Het
Thsd7a C T 6: 12,555,226 G220S probably benign Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r11 C T 5: 109,053,394 A415T probably damaging Het
Vmn2r88 A G 14: 51,413,978 M258V probably benign Het
Wiz G A 17: 32,357,898 R561C probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Other mutations in Scai
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Scai APN 2 39108394 missense probably damaging 1.00
IGL01366:Scai APN 2 39106961 missense probably benign 0.36
IGL01739:Scai APN 2 39094791 splice site probably benign
IGL02251:Scai APN 2 39099417 missense probably benign 0.01
IGL02274:Scai APN 2 39102317 unclassified probably benign
R0239:Scai UTSW 2 39075042 missense probably benign 0.00
R0239:Scai UTSW 2 39075042 missense probably benign 0.00
R0685:Scai UTSW 2 39103737 missense probably damaging 0.96
R0904:Scai UTSW 2 39075152 missense possibly damaging 0.90
R1655:Scai UTSW 2 39080117 missense possibly damaging 0.79
R1820:Scai UTSW 2 39106978 missense possibly damaging 0.82
R1913:Scai UTSW 2 39080081 missense probably damaging 1.00
R2068:Scai UTSW 2 39123013 missense probably damaging 1.00
R2183:Scai UTSW 2 39080126 missense probably benign 0.00
R3237:Scai UTSW 2 39150314 splice site probably benign
R5460:Scai UTSW 2 39083573 missense probably damaging 1.00
R5460:Scai UTSW 2 39083574 missense probably damaging 1.00
R6089:Scai UTSW 2 39083554 nonsense probably null
R6377:Scai UTSW 2 39102328 missense probably benign 0.02
R6606:Scai UTSW 2 39075135 missense probably benign 0.00
R7034:Scai UTSW 2 39121135 missense probably damaging 1.00
R7037:Scai UTSW 2 39190621 missense probably benign 0.04
R7171:Scai UTSW 2 39106936 missense possibly damaging 0.48
R7451:Scai UTSW 2 39125136 missense probably damaging 1.00
R7737:Scai UTSW 2 39123022 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGAGGTAAGTATCTAATGCCAAGAC -3'
(R):5'- GCATTACCACGTGTTTGAGGG -3'

Sequencing Primer
(F):5'- CCAAGTAACACACTATGTCA -3'
(R):5'- GCATTACCACGTGTTTGAGGGATAAC -3'
Posted On2015-04-17