Incidental Mutation 'R3933:Olfr1109'
ID308542
Institutional Source Beutler Lab
Gene Symbol Olfr1109
Ensembl Gene ENSMUSG00000075161
Gene Nameolfactory receptor 1109
SynonymsMOR172-5, GA_x6K02T2Q125-48586461-48585523
MMRRC Submission 040920-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R3933 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87091195-87096008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87092762 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 212 (I212F)
Ref Sequence ENSEMBL: ENSMUSP00000149282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099863] [ENSMUST00000214636] [ENSMUST00000217066]
Predicted Effect probably benign
Transcript: ENSMUST00000099863
AA Change: I212F

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000097449
Gene: ENSMUSG00000075161
AA Change: I212F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 8.3e-52 PFAM
Pfam:7tm_1 41 290 6.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214636
AA Change: I212F

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000217066
AA Change: I212F

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,354,856 F3350L probably damaging Het
Acp6 T C 3: 97,166,183 V146A probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Arhgef33 A G 17: 80,373,320 I630V probably benign Het
Astn2 G A 4: 66,403,955 R136C unknown Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
C1rl T A 6: 124,508,822 L384* probably null Het
Ccdc130 G A 8: 84,260,352 A172V probably benign Het
Ccdc6 TCCGCCGCCGCC TCCGCCGCC 10: 70,189,170 probably benign Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ercc5 T A 1: 44,167,856 M643K probably benign Het
Fut8 A C 12: 77,475,259 K557N probably damaging Het
Hsdl2 T C 4: 59,597,274 Y88H probably damaging Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Itga8 A G 2: 12,189,519 I690T probably benign Het
Lepr T C 4: 101,765,301 probably benign Het
Matn2 T C 15: 34,345,420 probably null Het
Mei1 A G 15: 82,083,152 K310E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Ogdh T C 11: 6,342,601 V438A possibly damaging Het
Olfr1293-ps T C 2: 111,527,955 Y232H probably damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Parp2 G A 14: 50,819,387 V323M probably benign Het
Pip5k1a A G 3: 95,072,003 S161P probably benign Het
Pold3 T C 7: 100,121,401 E8G probably damaging Het
Pomt1 G A 2: 32,245,619 V332I probably benign Het
Ppp2ca T A 11: 52,119,262 N232K probably damaging Het
Prune2 A T 19: 17,123,954 D2274V probably damaging Het
Pwwp2b G A 7: 139,256,034 V464I possibly damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rubcn A G 16: 32,829,259 probably null Het
Scai A T 2: 39,075,052 D593E probably benign Het
Slc24a2 T C 4: 87,176,185 T366A probably benign Het
Sp100 A G 1: 85,681,109 I320V probably benign Het
Syngr2 C A 11: 117,813,417 P206Q probably damaging Het
Tatdn3 A T 1: 191,046,324 probably null Het
Thsd7a C T 6: 12,555,226 G220S probably benign Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r11 C T 5: 109,053,394 A415T probably damaging Het
Vmn2r88 A G 14: 51,413,978 M258V probably benign Het
Wiz G A 17: 32,357,898 R561C probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Other mutations in Olfr1109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Olfr1109 APN 2 87093299 missense probably benign
IGL01926:Olfr1109 APN 2 87092974 missense probably damaging 1.00
IGL03195:Olfr1109 APN 2 87092569 missense probably damaging 1.00
R0550:Olfr1109 UTSW 2 87093129 missense probably benign 0.00
R1334:Olfr1109 UTSW 2 87093227 missense probably damaging 0.98
R1677:Olfr1109 UTSW 2 87092737 missense probably benign
R1753:Olfr1109 UTSW 2 87093227 missense probably damaging 0.98
R4151:Olfr1109 UTSW 2 87093170 missense probably benign 0.07
R4296:Olfr1109 UTSW 2 87092630 missense probably benign 0.00
R6654:Olfr1109 UTSW 2 87093050 missense probably benign 0.23
R6657:Olfr1109 UTSW 2 87093059 missense probably benign 0.00
R7697:Olfr1109 UTSW 2 87092818 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TGTTCCATGGAGTACTGAGAGC -3'
(R):5'- CATTCAGCATCTGTATTAGCATGG -3'

Sequencing Primer
(F):5'- GCTGGGCTGGATATAACTAAATGTTC -3'
(R):5'- GTGTGGCATCATTAATTCCCTGAC -3'
Posted On2015-04-17