Incidental Mutation 'R3933:Pip5k1a'
ID308543
Institutional Source Beutler Lab
Gene Symbol Pip5k1a
Ensembl Gene ENSMUSG00000028126
Gene Namephosphatidylinositol-4-phosphate 5-kinase, type 1 alpha
SynonymsPipk5a
MMRRC Submission 040920-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3933 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95058530-95106930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95072003 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 161 (S161P)
Ref Sequence ENSEMBL: ENSMUSP00000102855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005768] [ENSMUST00000107232] [ENSMUST00000107233] [ENSMUST00000107236]
Predicted Effect probably benign
Transcript: ENSMUST00000005768
AA Change: S160P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000005768
Gene: ENSMUSG00000028126
AA Change: S160P

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
PIPKc 93 434 2.79e-184 SMART
low complexity region 447 461 N/A INTRINSIC
low complexity region 508 523 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107231
Predicted Effect probably benign
Transcript: ENSMUST00000107232
AA Change: S160P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000102851
Gene: ENSMUSG00000028126
AA Change: S160P

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
PIPKc 93 434 2.79e-184 SMART
low complexity region 460 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107233
AA Change: S162P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000102852
Gene: ENSMUSG00000028126
AA Change: S162P

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 18 30 N/A INTRINSIC
PIPKc 95 436 2.79e-184 SMART
low complexity region 449 463 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107236
AA Change: S161P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000102855
Gene: ENSMUSG00000028126
AA Change: S161P

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 18 29 N/A INTRINSIC
PIPKc 94 435 2.79e-184 SMART
low complexity region 448 462 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
Meta Mutation Damage Score 0.0929 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 96% (43/45)
MGI Phenotype PHENOTYPE: A gene trap insertion into an intron of this gene results in no obvious phenotype. Mice homozygous for a knock-out allele exhibit partial lethality and reduced male fertility associated with asthenozoospermia and abnormal midpiece morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,354,856 F3350L probably damaging Het
Acp6 T C 3: 97,166,183 V146A probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Arhgef33 A G 17: 80,373,320 I630V probably benign Het
Astn2 G A 4: 66,403,955 R136C unknown Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
C1rl T A 6: 124,508,822 L384* probably null Het
Ccdc130 G A 8: 84,260,352 A172V probably benign Het
Ccdc6 TCCGCCGCCGCC TCCGCCGCC 10: 70,189,170 probably benign Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ercc5 T A 1: 44,167,856 M643K probably benign Het
Fut8 A C 12: 77,475,259 K557N probably damaging Het
Hsdl2 T C 4: 59,597,274 Y88H probably damaging Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Itga8 A G 2: 12,189,519 I690T probably benign Het
Lepr T C 4: 101,765,301 probably benign Het
Matn2 T C 15: 34,345,420 probably null Het
Mei1 A G 15: 82,083,152 K310E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Ogdh T C 11: 6,342,601 V438A possibly damaging Het
Olfr1109 T A 2: 87,092,762 I212F probably benign Het
Olfr1293-ps T C 2: 111,527,955 Y232H probably damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Parp2 G A 14: 50,819,387 V323M probably benign Het
Pold3 T C 7: 100,121,401 E8G probably damaging Het
Pomt1 G A 2: 32,245,619 V332I probably benign Het
Ppp2ca T A 11: 52,119,262 N232K probably damaging Het
Prune2 A T 19: 17,123,954 D2274V probably damaging Het
Pwwp2b G A 7: 139,256,034 V464I possibly damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rubcn A G 16: 32,829,259 probably null Het
Scai A T 2: 39,075,052 D593E probably benign Het
Slc24a2 T C 4: 87,176,185 T366A probably benign Het
Sp100 A G 1: 85,681,109 I320V probably benign Het
Syngr2 C A 11: 117,813,417 P206Q probably damaging Het
Tatdn3 A T 1: 191,046,324 probably null Het
Thsd7a C T 6: 12,555,226 G220S probably benign Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r11 C T 5: 109,053,394 A415T probably damaging Het
Vmn2r88 A G 14: 51,413,978 M258V probably benign Het
Wiz G A 17: 32,357,898 R561C probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Other mutations in Pip5k1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Pip5k1a APN 3 95068160 missense probably benign 0.15
IGL01647:Pip5k1a APN 3 95074072 missense probably damaging 1.00
IGL02536:Pip5k1a APN 3 95064396 missense probably benign 0.01
IGL02612:Pip5k1a APN 3 95067413 missense probably benign 0.02
Biden UTSW 3 95068121 missense probably damaging 1.00
Time UTSW 3 95060498 missense possibly damaging 0.76
R0109:Pip5k1a UTSW 3 95065442 missense probably benign 0.03
R0217:Pip5k1a UTSW 3 95073991 critical splice donor site probably null
R0891:Pip5k1a UTSW 3 95065520 splice site probably benign
R1157:Pip5k1a UTSW 3 95078112 missense probably benign 0.15
R1692:Pip5k1a UTSW 3 95063730 missense probably benign 0.00
R2176:Pip5k1a UTSW 3 95065496 missense probably damaging 1.00
R2187:Pip5k1a UTSW 3 95071918 missense probably damaging 1.00
R3693:Pip5k1a UTSW 3 95078187 splice site probably benign
R4405:Pip5k1a UTSW 3 95068059 critical splice donor site probably null
R4903:Pip5k1a UTSW 3 95070783 missense probably benign 0.01
R4964:Pip5k1a UTSW 3 95070783 missense probably benign 0.01
R5652:Pip5k1a UTSW 3 95067439 missense probably benign
R6314:Pip5k1a UTSW 3 95068121 missense probably damaging 1.00
R6954:Pip5k1a UTSW 3 95068247 missense probably damaging 1.00
R7090:Pip5k1a UTSW 3 95060498 missense possibly damaging 0.76
R7432:Pip5k1a UTSW 3 95074120 missense probably benign 0.01
X0017:Pip5k1a UTSW 3 95078163 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACTATCACTGGCTCTGCTG -3'
(R):5'- CTGTAAAATGGATGTGATTCTCCCTAC -3'

Sequencing Primer
(F):5'- TATCACTGGCTCTGCTGAGGAC -3'
(R):5'- ACTCACTCTGTAGACCAGGCTG -3'
Posted On2015-04-17