Incidental Mutation 'R3933:Acp6'
ID308544
Institutional Source Beutler Lab
Gene Symbol Acp6
Ensembl Gene ENSMUSG00000028093
Gene Nameacid phosphatase 6, lysophosphatidic
SynonymsACPL1, 5730559A09Rik, mPACPL1
MMRRC Submission 040920-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R3933 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location97158777-97177299 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97166183 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 146 (V146A)
Ref Sequence ENSEMBL: ENSMUSP00000088263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090759]
Predicted Effect probably benign
Transcript: ENSMUST00000090759
AA Change: V146A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000088263
Gene: ENSMUSG00000028093
AA Change: V146A

DomainStartEndE-ValueType
Pfam:His_Phos_2 42 228 4.6e-20 PFAM
Pfam:His_Phos_2 245 371 8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149900
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the histidine acid phosphatase protein family. The encoded protein hydrolyzes lysophosphatidic acid, which is involved in G protein-coupled receptor signaling, lipid raft modulation, and in balancing lipid composition within the cell. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2016]
PHENOTYPE: Phenotypic analysis of mice homozygous for a gene trap allele indicates this mutation has no notable phenotype in any parameter tested. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,354,856 F3350L probably damaging Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Arhgef33 A G 17: 80,373,320 I630V probably benign Het
Astn2 G A 4: 66,403,955 R136C unknown Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
C1rl T A 6: 124,508,822 L384* probably null Het
Ccdc130 G A 8: 84,260,352 A172V probably benign Het
Ccdc6 TCCGCCGCCGCC TCCGCCGCC 10: 70,189,170 probably benign Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ercc5 T A 1: 44,167,856 M643K probably benign Het
Fut8 A C 12: 77,475,259 K557N probably damaging Het
Hsdl2 T C 4: 59,597,274 Y88H probably damaging Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Itga8 A G 2: 12,189,519 I690T probably benign Het
Lepr T C 4: 101,765,301 probably benign Het
Matn2 T C 15: 34,345,420 probably null Het
Mei1 A G 15: 82,083,152 K310E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Ogdh T C 11: 6,342,601 V438A possibly damaging Het
Olfr1109 T A 2: 87,092,762 I212F probably benign Het
Olfr1293-ps T C 2: 111,527,955 Y232H probably damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Parp2 G A 14: 50,819,387 V323M probably benign Het
Pip5k1a A G 3: 95,072,003 S161P probably benign Het
Pold3 T C 7: 100,121,401 E8G probably damaging Het
Pomt1 G A 2: 32,245,619 V332I probably benign Het
Ppp2ca T A 11: 52,119,262 N232K probably damaging Het
Prune2 A T 19: 17,123,954 D2274V probably damaging Het
Pwwp2b G A 7: 139,256,034 V464I possibly damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rubcn A G 16: 32,829,259 probably null Het
Scai A T 2: 39,075,052 D593E probably benign Het
Slc24a2 T C 4: 87,176,185 T366A probably benign Het
Sp100 A G 1: 85,681,109 I320V probably benign Het
Syngr2 C A 11: 117,813,417 P206Q probably damaging Het
Tatdn3 A T 1: 191,046,324 probably null Het
Thsd7a C T 6: 12,555,226 G220S probably benign Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r11 C T 5: 109,053,394 A415T probably damaging Het
Vmn2r88 A G 14: 51,413,978 M258V probably benign Het
Wiz G A 17: 32,357,898 R561C probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Other mutations in Acp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Acp6 APN 3 97176421 missense possibly damaging 0.94
IGL01610:Acp6 APN 3 97175720 missense possibly damaging 0.81
IGL01655:Acp6 APN 3 97165972 critical splice donor site probably null
IGL01788:Acp6 APN 3 97165882 missense probably damaging 1.00
IGL01845:Acp6 APN 3 97173807 missense probably benign 0.00
IGL02978:Acp6 APN 3 97166559 missense probably benign 0.30
IGL03180:Acp6 APN 3 97175635 missense probably benign 0.15
R0144:Acp6 UTSW 3 97165829 splice site probably benign
R0471:Acp6 UTSW 3 97168575 critical splice donor site probably null
R1458:Acp6 UTSW 3 97173788 splice site probably benign
R1889:Acp6 UTSW 3 97165885 missense probably damaging 0.98
R1990:Acp6 UTSW 3 97175738 missense probably damaging 1.00
R2051:Acp6 UTSW 3 97168017 missense probably benign 0.00
R3786:Acp6 UTSW 3 97159289 missense probably damaging 0.98
R4271:Acp6 UTSW 3 97166618 critical splice donor site probably null
R4604:Acp6 UTSW 3 97175759 missense probably benign 0.23
R4864:Acp6 UTSW 3 97159367 critical splice donor site probably null
R4935:Acp6 UTSW 3 97171744 critical splice donor site probably null
R5076:Acp6 UTSW 3 97167989 missense probably benign 0.01
R5255:Acp6 UTSW 3 97167996 missense probably benign 0.11
R5896:Acp6 UTSW 3 97168494 missense probably benign 0.03
R5959:Acp6 UTSW 3 97166572 missense probably damaging 1.00
R6004:Acp6 UTSW 3 97175681 missense probably benign 0.11
R6938:Acp6 UTSW 3 97175633 missense probably benign 0.04
R7593:Acp6 UTSW 3 97165950 missense probably benign 0.30
X0067:Acp6 UTSW 3 97165957 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTTCAGGGATTCTCCTCTGG -3'
(R):5'- GGGAGAAAGCCTTTCCTCTC -3'

Sequencing Primer
(F):5'- CTCCTCTGGGCTGAGTTGAGC -3'
(R):5'- GGGAGAAAGCCTTTCCTCTCTACAG -3'
Posted On2015-04-17