Incidental Mutation 'R3933:Vmn2r10'
ID308550
Institutional Source Beutler Lab
Gene Symbol Vmn2r10
Ensembl Gene ENSMUSG00000067010
Gene Namevomeronasal 2, receptor 10
SynonymsV2r16, VR16
MMRRC Submission 040920-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R3933 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location108993412-109006471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 109002222 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 319 (A319S)
Ref Sequence ENSEMBL: ENSMUSP00000078162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079163] [ENSMUST00000176594]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079163
AA Change: A319S

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078162
Gene: ENSMUSG00000067010
AA Change: A319S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 464 8.5e-29 PFAM
Pfam:NCD3G 506 560 3.8e-17 PFAM
Pfam:7tm_3 593 828 4e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176594
SMART Domains Protein: ENSMUSP00000135274
Gene: ENSMUSG00000067010

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 96% (43/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,354,856 F3350L probably damaging Het
Acp6 T C 3: 97,166,183 V146A probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Arhgef33 A G 17: 80,373,320 I630V probably benign Het
Astn2 G A 4: 66,403,955 R136C unknown Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
C1rl T A 6: 124,508,822 L384* probably null Het
Ccdc130 G A 8: 84,260,352 A172V probably benign Het
Ccdc6 TCCGCCGCCGCC TCCGCCGCC 10: 70,189,170 probably benign Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ercc5 T A 1: 44,167,856 M643K probably benign Het
Fut8 A C 12: 77,475,259 K557N probably damaging Het
Hsdl2 T C 4: 59,597,274 Y88H probably damaging Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Itga8 A G 2: 12,189,519 I690T probably benign Het
Lepr T C 4: 101,765,301 probably benign Het
Matn2 T C 15: 34,345,420 probably null Het
Mei1 A G 15: 82,083,152 K310E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Ogdh T C 11: 6,342,601 V438A possibly damaging Het
Olfr1109 T A 2: 87,092,762 I212F probably benign Het
Olfr1293-ps T C 2: 111,527,955 Y232H probably damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Parp2 G A 14: 50,819,387 V323M probably benign Het
Pip5k1a A G 3: 95,072,003 S161P probably benign Het
Pold3 T C 7: 100,121,401 E8G probably damaging Het
Pomt1 G A 2: 32,245,619 V332I probably benign Het
Ppp2ca T A 11: 52,119,262 N232K probably damaging Het
Prune2 A T 19: 17,123,954 D2274V probably damaging Het
Pwwp2b G A 7: 139,256,034 V464I possibly damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rubcn A G 16: 32,829,259 probably null Het
Scai A T 2: 39,075,052 D593E probably benign Het
Slc24a2 T C 4: 87,176,185 T366A probably benign Het
Sp100 A G 1: 85,681,109 I320V probably benign Het
Syngr2 C A 11: 117,813,417 P206Q probably damaging Het
Tatdn3 A T 1: 191,046,324 probably null Het
Thsd7a C T 6: 12,555,226 G220S probably benign Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Vmn2r11 C T 5: 109,053,394 A415T probably damaging Het
Vmn2r88 A G 14: 51,413,978 M258V probably benign Het
Wiz G A 17: 32,357,898 R561C probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Other mutations in Vmn2r10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Vmn2r10 APN 5 109002585 missense possibly damaging 0.75
IGL01618:Vmn2r10 APN 5 109002479 missense probably damaging 1.00
IGL01624:Vmn2r10 APN 5 109006246 missense possibly damaging 0.83
IGL01941:Vmn2r10 APN 5 108995954 missense probably damaging 1.00
IGL01959:Vmn2r10 APN 5 108997705 missense probably benign 0.00
IGL01973:Vmn2r10 APN 5 108995677 missense probably damaging 1.00
IGL01985:Vmn2r10 APN 5 109006259 missense probably benign 0.21
IGL02451:Vmn2r10 APN 5 108995922 nonsense probably null
IGL02503:Vmn2r10 APN 5 109003475 missense probably damaging 1.00
IGL03275:Vmn2r10 APN 5 109003377 missense probably benign 0.00
R0035:Vmn2r10 UTSW 5 108997601 splice site probably benign
R0395:Vmn2r10 UTSW 5 109001993 missense probably damaging 1.00
R0454:Vmn2r10 UTSW 5 109003461 missense probably benign 0.25
R0648:Vmn2r10 UTSW 5 108995916 missense probably benign 0.00
R1251:Vmn2r10 UTSW 5 108996024 missense probably benign 0.01
R1580:Vmn2r10 UTSW 5 109006251 missense possibly damaging 0.82
R1845:Vmn2r10 UTSW 5 109001995 nonsense probably null
R1986:Vmn2r10 UTSW 5 109006254 nonsense probably null
R2137:Vmn2r10 UTSW 5 109003544 missense possibly damaging 0.87
R2495:Vmn2r10 UTSW 5 108996095 missense probably damaging 1.00
R3932:Vmn2r10 UTSW 5 109002222 missense possibly damaging 0.47
R4899:Vmn2r10 UTSW 5 109003458 missense probably damaging 1.00
R4992:Vmn2r10 UTSW 5 108997726 missense possibly damaging 0.89
R5124:Vmn2r10 UTSW 5 109006420 missense probably benign 0.01
R5145:Vmn2r10 UTSW 5 108995895 missense possibly damaging 0.64
R5156:Vmn2r10 UTSW 5 108995600 missense probably benign 0.11
R5265:Vmn2r10 UTSW 5 108995720 missense probably damaging 1.00
R5311:Vmn2r10 UTSW 5 109006255 missense probably damaging 1.00
R5321:Vmn2r10 UTSW 5 108995639 missense probably damaging 1.00
R5666:Vmn2r10 UTSW 5 108999044 nonsense probably null
R5670:Vmn2r10 UTSW 5 108999044 nonsense probably null
R5872:Vmn2r10 UTSW 5 109003511 missense possibly damaging 0.84
R6004:Vmn2r10 UTSW 5 108999078 missense probably benign 0.30
R6108:Vmn2r10 UTSW 5 108995801 missense probably damaging 1.00
R6332:Vmn2r10 UTSW 5 109003462 missense probably damaging 1.00
R6599:Vmn2r10 UTSW 5 108996078 missense probably benign 0.09
R6651:Vmn2r10 UTSW 5 108995622 missense probably null 0.22
R6891:Vmn2r10 UTSW 5 109001979 missense probably damaging 1.00
R7023:Vmn2r10 UTSW 5 109002028 missense probably damaging 0.96
R7146:Vmn2r10 UTSW 5 109003334 missense probably damaging 1.00
Z1088:Vmn2r10 UTSW 5 108996113 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCATTCCAATGTGTTGTTGAATG -3'
(R):5'- ACATGCAGTTATATATGACAAGGGC -3'

Sequencing Primer
(F):5'- TCCAATGTGTTGTTGAATGTAAAATG -3'
(R):5'- TTATGGAATCAACAGCAAAGGTTG -3'
Posted On2015-04-17