Mutagenetix > Incidental Mutations

Incidental Mutation 'R3933:Vmn2r11'

308551

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r11

Ensembl Gene

ENSMUSG00000091450

Gene Name

vomeronasal 2, receptor 11

Synonyms

EG384219

MMRRC Submission

040920-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R3933 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

109046873-109059452 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 109053394 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 415 (A415T)

Ref Sequence

ENSEMBL: ENSMUSP00000133218 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164875]

Predicted Effect

probably damaging
Transcript: ENSMUST00000164875
AA Change: A415T

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000133218
Gene: ENSMUSG00000091450
AA Change: A415T

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	167	475	1.6e-29	PFAM
Pfam:NCD3G	520	574	9.1e-19	PFAM
Pfam:7tm_3	607	842	4.6e-55	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.1%
20x: 94.1%

Validation Efficiency

96% (43/45)

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,354,856	F3350L	probably damaging	Het
Acp6	T	C	3: 97,166,183	V146A	probably benign	Het
Ap3b2	C	T	7: 81,473,850		probably benign	Het
Arhgef33	A	G	17: 80,373,320	I630V	probably benign	Het
Astn2	G	A	4: 66,403,955	R136C	unknown	Het
Bcl2l14	A	G	6: 134,423,808	D64G	probably damaging	Het
C1rl	T	A	6: 124,508,822	L384*	probably null	Het
Ccdc130	G	A	8: 84,260,352	A172V	probably benign	Het
Ccdc6	TCCGCCGCCGCC	TCCGCCGCC	10: 70,189,170		probably benign	Het
Coch	T	C	12: 51,603,338	I370T	probably damaging	Het
Ercc5	T	A	1: 44,167,856	M643K	probably benign	Het
Fut8	A	C	12: 77,475,259	K557N	probably damaging	Het
Hsdl2	T	C	4: 59,597,274	Y88H	probably damaging	Het
Hspg2	T	C	4: 137,515,568	V670A	probably damaging	Het
Itga8	A	G	2: 12,189,519	I690T	probably benign	Het
Lepr	T	C	4: 101,765,301		probably benign	Het
Matn2	T	C	15: 34,345,420		probably null	Het
Mei1	A	G	15: 82,083,152	K310E	possibly damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Msl3	C	T	X: 168,671,817	A87T	probably damaging	Het
Ogdh	T	C	11: 6,342,601	V438A	possibly damaging	Het
Olfr1109	T	A	2: 87,092,762	I212F	probably benign	Het
Olfr1293-ps	T	C	2: 111,527,955	Y232H	probably damaging	Het
Opa1	A	T	16: 29,610,880	E401D	probably damaging	Het
Parp2	G	A	14: 50,819,387	V323M	probably benign	Het
Pip5k1a	A	G	3: 95,072,003	S161P	probably benign	Het
Pold3	T	C	7: 100,121,401	E8G	probably damaging	Het
Pomt1	G	A	2: 32,245,619	V332I	probably benign	Het
Ppp2ca	T	A	11: 52,119,262	N232K	probably damaging	Het
Prune2	A	T	19: 17,123,954	D2274V	probably damaging	Het
Pwwp2b	G	A	7: 139,256,034	V464I	possibly damaging	Het
Rgs7bp	T	C	13: 105,052,998	M98V	probably benign	Het
Rubcn	A	G	16: 32,829,259		probably null	Het
Scai	A	T	2: 39,075,052	D593E	probably benign	Het
Slc24a2	T	C	4: 87,176,185	T366A	probably benign	Het
Sp100	A	G	1: 85,681,109	I320V	probably benign	Het
Syngr2	C	A	11: 117,813,417	P206Q	probably damaging	Het
Tatdn3	A	T	1: 191,046,324		probably null	Het
Thsd7a	C	T	6: 12,555,226	G220S	probably benign	Het
Tmem28	G	A	X: 99,821,864	V266M	possibly damaging	Het
Vmn2r10	C	A	5: 109,002,222	A319S	possibly damaging	Het
Vmn2r88	A	G	14: 51,413,978	M258V	probably benign	Het
Wiz	G	A	17: 32,357,898	R561C	probably damaging	Het
Zfp422	T	C	6: 116,626,459	K193R	probably benign	Het

Other mutations in Vmn2r11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00925:Vmn2r11	APN	5	109047019	missense	probably benign	0.00
IGL01677:Vmn2r11	APN	5	109053957	missense	possibly damaging	0.50
IGL02048:Vmn2r11	APN	5	109054792	missense	probably benign	0.00
IGL02559:Vmn2r11	APN	5	109052180	missense	probably damaging	0.98
IGL02879:Vmn2r11	APN	5	109053838	missense	possibly damaging	0.95
IGL03084:Vmn2r11	APN	5	109059343	missense	probably benign	0.00
IGL03163:Vmn2r11	APN	5	109053826	missense	probably benign	0.41
IGL03289:Vmn2r11	APN	5	109048922	splice site	probably benign
IGL03294:Vmn2r11	APN	5	109054069	missense	probably benign	0.22
R0233:Vmn2r11	UTSW	5	109054102	missense	probably benign	0.16
R0233:Vmn2r11	UTSW	5	109054102	missense	probably benign	0.16
R0421:Vmn2r11	UTSW	5	109059428	missense	probably benign	0.00
R0549:Vmn2r11	UTSW	5	109052097	missense	possibly damaging	0.80
R0628:Vmn2r11	UTSW	5	109047731	missense	possibly damaging	0.88
R1523:Vmn2r11	UTSW	5	109053841	missense	probably benign	0.25
R1660:Vmn2r11	UTSW	5	109053858	missense	possibly damaging	0.79
R1827:Vmn2r11	UTSW	5	109052072	missense	probably benign	0.01
R1913:Vmn2r11	UTSW	5	109054788	missense	probably benign
R2260:Vmn2r11	UTSW	5	109053791	nonsense	probably null
R2400:Vmn2r11	UTSW	5	109052062	missense	probably benign	0.03
R4091:Vmn2r11	UTSW	5	109054750	critical splice donor site	probably null
R4624:Vmn2r11	UTSW	5	109052235	missense	probably damaging	0.99
R4762:Vmn2r11	UTSW	5	109047570	missense	probably damaging	1.00
R5256:Vmn2r11	UTSW	5	109054792	missense	probably benign	0.26
R5370:Vmn2r11	UTSW	5	109047555	missense	probably damaging	1.00
R5419:Vmn2r11	UTSW	5	109059358	missense	possibly damaging	0.55
R5516:Vmn2r11	UTSW	5	109047166	missense	probably damaging	0.98
R5643:Vmn2r11	UTSW	5	109047003	missense	probably damaging	1.00
R5671:Vmn2r11	UTSW	5	109054906	missense	probably benign	0.03
R5679:Vmn2r11	UTSW	5	109054842	missense	probably benign	0.00
R5739:Vmn2r11	UTSW	5	109059248	critical splice donor site	probably null
R5746:Vmn2r11	UTSW	5	109053694	missense	probably benign	0.41
R5995:Vmn2r11	UTSW	5	109047055	missense	probably damaging	1.00
R6147:Vmn2r11	UTSW	5	109054834	missense	probably benign	0.04
R6220:Vmn2r11	UTSW	5	109053568	missense	probably benign	0.09
R6374:Vmn2r11	UTSW	5	109053813	missense	possibly damaging	0.65
R6491:Vmn2r11	UTSW	5	109048934	missense	possibly damaging	0.95
R6804:Vmn2r11	UTSW	5	109053484	missense	probably damaging	1.00
R6814:Vmn2r11	UTSW	5	109047110	missense	possibly damaging	0.81
R6872:Vmn2r11	UTSW	5	109047110	missense	possibly damaging	0.81
R7014:Vmn2r11	UTSW	5	109053423	missense	probably damaging	1.00
R7041:Vmn2r11	UTSW	5	109054950	missense	probably damaging	1.00
R7043:Vmn2r11	UTSW	5	109052232	missense	probably benign	0.00
R7050:Vmn2r11	UTSW	5	109054791	missense	probably benign	0.05
R7184:Vmn2r11	UTSW	5	109053415	missense	probably damaging	1.00
R7388:Vmn2r11	UTSW	5	109054876	missense	probably benign	0.05
R7477:Vmn2r11	UTSW	5	109059348	missense	possibly damaging	0.67
R7524:Vmn2r11	UTSW	5	109053982	missense	probably benign	0.01
R7682:Vmn2r11	UTSW	5	109047615	missense	probably benign	0.02
R7715:Vmn2r11	UTSW	5	109047441	missense	probably damaging	0.99
R7869:Vmn2r11	UTSW	5	109052120	missense	probably damaging	1.00
R8094:Vmn2r11	UTSW	5	109053760	missense	probably damaging	1.00
R8277:Vmn2r11	UTSW	5	109054967	missense	probably benign	0.00
R8506:Vmn2r11	UTSW	5	109059404	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGGGTAGAAATCTTTCCACTGAG -3'
(R):5'- ACTTTTGAACACCACCACAGTG -3'

Sequencing Primer
(F):5'- GCAGTTATTTCTCTGGGTC -3'
(R):5'- ACCACAGTGAGATTGCTAAATTTAAG -3'

Posted On

2015-04-17