Incidental Mutation 'R3933:C1rl'
ID308554
Institutional Source Beutler Lab
Gene Symbol C1rl
Ensembl Gene ENSMUSG00000038527
Gene Namecomplement component 1, r subcomponent-like
SynonymsC1rl1, C1r-LP
MMRRC Submission 040920-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3933 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location124493113-124510643 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 124508822 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 384 (L384*)
Ref Sequence ENSEMBL: ENSMUSP00000042883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049124] [ENSMUST00000068593]
Predicted Effect probably null
Transcript: ENSMUST00000049124
AA Change: L384*
SMART Domains Protein: ENSMUSP00000042883
Gene: ENSMUSG00000038527
AA Change: L384*

DomainStartEndE-ValueType
CUB 42 166 3.19e-18 SMART
Tryp_SPc 239 474 1.25e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068593
SMART Domains Protein: ENSMUSP00000063707
Gene: ENSMUSG00000055172

DomainStartEndE-ValueType
CUB 14 140 1.56e-35 SMART
EGF_CA 141 189 1.88e-10 SMART
CUB 192 304 4.74e-35 SMART
CCP 308 370 5.56e-9 SMART
CCP 375 446 1.53e-6 SMART
Tryp_SPc 462 699 2.7e-71 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 96% (43/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,354,856 F3350L probably damaging Het
Acp6 T C 3: 97,166,183 V146A probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Arhgef33 A G 17: 80,373,320 I630V probably benign Het
Astn2 G A 4: 66,403,955 R136C unknown Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
Ccdc130 G A 8: 84,260,352 A172V probably benign Het
Ccdc6 TCCGCCGCCGCC TCCGCCGCC 10: 70,189,170 probably benign Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ercc5 T A 1: 44,167,856 M643K probably benign Het
Fut8 A C 12: 77,475,259 K557N probably damaging Het
Hsdl2 T C 4: 59,597,274 Y88H probably damaging Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Itga8 A G 2: 12,189,519 I690T probably benign Het
Lepr T C 4: 101,765,301 probably benign Het
Matn2 T C 15: 34,345,420 probably null Het
Mei1 A G 15: 82,083,152 K310E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Ogdh T C 11: 6,342,601 V438A possibly damaging Het
Olfr1109 T A 2: 87,092,762 I212F probably benign Het
Olfr1293-ps T C 2: 111,527,955 Y232H probably damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Parp2 G A 14: 50,819,387 V323M probably benign Het
Pip5k1a A G 3: 95,072,003 S161P probably benign Het
Pold3 T C 7: 100,121,401 E8G probably damaging Het
Pomt1 G A 2: 32,245,619 V332I probably benign Het
Ppp2ca T A 11: 52,119,262 N232K probably damaging Het
Prune2 A T 19: 17,123,954 D2274V probably damaging Het
Pwwp2b G A 7: 139,256,034 V464I possibly damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rubcn A G 16: 32,829,259 probably null Het
Scai A T 2: 39,075,052 D593E probably benign Het
Slc24a2 T C 4: 87,176,185 T366A probably benign Het
Sp100 A G 1: 85,681,109 I320V probably benign Het
Syngr2 C A 11: 117,813,417 P206Q probably damaging Het
Tatdn3 A T 1: 191,046,324 probably null Het
Thsd7a C T 6: 12,555,226 G220S probably benign Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r11 C T 5: 109,053,394 A415T probably damaging Het
Vmn2r88 A G 14: 51,413,978 M258V probably benign Het
Wiz G A 17: 32,357,898 R561C probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Other mutations in C1rl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02435:C1rl APN 6 124508873 missense probably damaging 1.00
IGL02549:C1rl APN 6 124493837 missense possibly damaging 0.76
IGL02581:C1rl APN 6 124493154 missense possibly damaging 0.83
IGL02642:C1rl APN 6 124493847 missense possibly damaging 0.60
IGL02950:C1rl APN 6 124508861 missense probably damaging 1.00
IGL02980:C1rl UTSW 6 124508528 missense probably benign 0.00
R0699:C1rl UTSW 6 124508636 missense probably benign 0.14
R0848:C1rl UTSW 6 124508506 missense probably benign 0.29
R1221:C1rl UTSW 6 124493981 missense probably benign 0.43
R1654:C1rl UTSW 6 124493910 missense probably damaging 0.97
R1957:C1rl UTSW 6 124509062 missense probably damaging 1.00
R2055:C1rl UTSW 6 124493822 missense probably benign 0.01
R2120:C1rl UTSW 6 124508713 missense probably damaging 0.99
R2262:C1rl UTSW 6 124506948 missense probably damaging 0.99
R2363:C1rl UTSW 6 124509110 missense probably benign 0.13
R4824:C1rl UTSW 6 124509081 nonsense probably null
R5228:C1rl UTSW 6 124508468 missense probably damaging 1.00
R5414:C1rl UTSW 6 124508468 missense probably damaging 1.00
R6008:C1rl UTSW 6 124493188 missense probably benign 0.00
R6467:C1rl UTSW 6 124508576 missense probably benign 0.03
R6549:C1rl UTSW 6 124508528 missense probably benign 0.00
R6609:C1rl UTSW 6 124508624 missense probably benign 0.44
R6998:C1rl UTSW 6 124508902 missense probably damaging 1.00
R7037:C1rl UTSW 6 124508639 missense probably damaging 1.00
R8176:C1rl UTSW 6 124493885 missense probably benign 0.00
Z1088:C1rl UTSW 6 124508742 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTCCCACAACTTCAATGGAG -3'
(R):5'- TTGGTGTAGAAGCCGTACCC -3'

Sequencing Primer
(F):5'- AGATATTGCTCTCCTGGAACTTGAGC -3'
(R):5'- AGGATACAATGCCTGTGGCCAC -3'
Posted On2015-04-17