Incidental Mutation 'R3933:Bcl2l14'
ID308555
Institutional Source Beutler Lab
Gene Symbol Bcl2l14
Ensembl Gene ENSMUSG00000030200
Gene NameBCL2-like 14 (apoptosis facilitator)
Synonyms
MMRRC Submission 040920-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R3933 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location134396318-134438736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134423808 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 64 (D64G)
Ref Sequence ENSEMBL: ENSMUSP00000132525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032321] [ENSMUST00000111960] [ENSMUST00000127865] [ENSMUST00000163589]
Predicted Effect probably damaging
Transcript: ENSMUST00000032321
AA Change: D64G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032321
Gene: ENSMUSG00000030200
AA Change: D64G

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
SCOP:d1maz__ 200 320 5e-23 SMART
Blast:BCL 217 316 4e-43 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111960
AA Change: D64G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107591
Gene: ENSMUSG00000030200
AA Change: D64G

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
SCOP:d1maz__ 200 320 5e-23 SMART
Blast:BCL 217 316 4e-43 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000127865
AA Change: D64G

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115608
Gene: ENSMUSG00000030200
AA Change: D64G

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142612
Predicted Effect probably damaging
Transcript: ENSMUST00000163589
AA Change: D64G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132525
Gene: ENSMUSG00000030200
AA Change: D64G

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
SCOP:d1maz__ 200 320 5e-23 SMART
Blast:BCL 217 316 4e-43 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205104
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. Overexpression of this gene has been shown to induce apoptosis in cells. Three alternatively spliced transcript variants encoding two distinct isoforms have been reported for this gene. [provided by RefSeq, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,354,856 F3350L probably damaging Het
Acp6 T C 3: 97,166,183 V146A probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Arhgef33 A G 17: 80,373,320 I630V probably benign Het
Astn2 G A 4: 66,403,955 R136C unknown Het
C1rl T A 6: 124,508,822 L384* probably null Het
Ccdc130 G A 8: 84,260,352 A172V probably benign Het
Ccdc6 TCCGCCGCCGCC TCCGCCGCC 10: 70,189,170 probably benign Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ercc5 T A 1: 44,167,856 M643K probably benign Het
Fut8 A C 12: 77,475,259 K557N probably damaging Het
Hsdl2 T C 4: 59,597,274 Y88H probably damaging Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Itga8 A G 2: 12,189,519 I690T probably benign Het
Lepr T C 4: 101,765,301 probably benign Het
Matn2 T C 15: 34,345,420 probably null Het
Mei1 A G 15: 82,083,152 K310E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Ogdh T C 11: 6,342,601 V438A possibly damaging Het
Olfr1109 T A 2: 87,092,762 I212F probably benign Het
Olfr1293-ps T C 2: 111,527,955 Y232H probably damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Parp2 G A 14: 50,819,387 V323M probably benign Het
Pip5k1a A G 3: 95,072,003 S161P probably benign Het
Pold3 T C 7: 100,121,401 E8G probably damaging Het
Pomt1 G A 2: 32,245,619 V332I probably benign Het
Ppp2ca T A 11: 52,119,262 N232K probably damaging Het
Prune2 A T 19: 17,123,954 D2274V probably damaging Het
Pwwp2b G A 7: 139,256,034 V464I possibly damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rubcn A G 16: 32,829,259 probably null Het
Scai A T 2: 39,075,052 D593E probably benign Het
Slc24a2 T C 4: 87,176,185 T366A probably benign Het
Sp100 A G 1: 85,681,109 I320V probably benign Het
Syngr2 C A 11: 117,813,417 P206Q probably damaging Het
Tatdn3 A T 1: 191,046,324 probably null Het
Thsd7a C T 6: 12,555,226 G220S probably benign Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r11 C T 5: 109,053,394 A415T probably damaging Het
Vmn2r88 A G 14: 51,413,978 M258V probably benign Het
Wiz G A 17: 32,357,898 R561C probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Other mutations in Bcl2l14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Bcl2l14 APN 6 134423865 missense probably damaging 1.00
IGL02451:Bcl2l14 APN 6 134423841 missense probably benign 0.18
R1115:Bcl2l14 UTSW 6 134432139 splice site probably benign
R1482:Bcl2l14 UTSW 6 134427302 missense probably damaging 1.00
R1952:Bcl2l14 UTSW 6 134432366 missense probably damaging 1.00
R3932:Bcl2l14 UTSW 6 134423808 missense probably damaging 0.98
R5772:Bcl2l14 UTSW 6 134427399 missense probably damaging 0.98
R6295:Bcl2l14 UTSW 6 134427407 missense probably benign 0.40
R7078:Bcl2l14 UTSW 6 134423823 missense probably damaging 0.98
R7496:Bcl2l14 UTSW 6 134427454 missense probably benign 0.00
R7785:Bcl2l14 UTSW 6 134432260 missense possibly damaging 0.96
R7792:Bcl2l14 UTSW 6 134432314 missense possibly damaging 0.84
X0062:Bcl2l14 UTSW 6 134427371 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAGTGTGTATGACCTGGAAGAC -3'
(R):5'- GAGCTGTTCACAAGCCTACC -3'

Sequencing Primer
(F):5'- ACATTCCCCTGGAGGATGATGATC -3'
(R):5'- TGCTCCACACTGCTCAGAG -3'
Posted On2015-04-17