Incidental Mutation 'R3933:Pold3'
ID308557
Institutional Source Beutler Lab
Gene Symbol Pold3
Ensembl Gene ENSMUSG00000030726
Gene Namepolymerase (DNA-directed), delta 3, accessory subunit
SynonymsP66, C85233, P68, GC12, 2410142G14Rik
MMRRC Submission 040920-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3933 (G1)
Quality Score175
Status Validated
Chromosome7
Chromosomal Location100082111-100121565 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100121401 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 8 (E8G)
Ref Sequence ENSEMBL: ENSMUSP00000032969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032969] [ENSMUST00000127128] [ENSMUST00000156202] [ENSMUST00000208184] [ENSMUST00000208670]
Predicted Effect probably damaging
Transcript: ENSMUST00000032969
AA Change: E8G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032969
Gene: ENSMUSG00000030726
AA Change: E8G

DomainStartEndE-ValueType
Pfam:CDC27 19 461 1.6e-142 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000127128
AA Change: E8G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000156202
Predicted Effect probably benign
Transcript: ENSMUST00000208184
Predicted Effect probably benign
Transcript: ENSMUST00000208670
Meta Mutation Damage Score 0.5830 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 66-kDa subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. The encoded protein plays a role in regulating the activity of DNA polymerase delta through interactions with other subunits and the processivity cofactor proliferating cell nuclear antigen (PCNA). Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,354,856 F3350L probably damaging Het
Acp6 T C 3: 97,166,183 V146A probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Arhgef33 A G 17: 80,373,320 I630V probably benign Het
Astn2 G A 4: 66,403,955 R136C unknown Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
C1rl T A 6: 124,508,822 L384* probably null Het
Ccdc130 G A 8: 84,260,352 A172V probably benign Het
Ccdc6 TCCGCCGCCGCC TCCGCCGCC 10: 70,189,170 probably benign Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ercc5 T A 1: 44,167,856 M643K probably benign Het
Fut8 A C 12: 77,475,259 K557N probably damaging Het
Hsdl2 T C 4: 59,597,274 Y88H probably damaging Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Itga8 A G 2: 12,189,519 I690T probably benign Het
Lepr T C 4: 101,765,301 probably benign Het
Matn2 T C 15: 34,345,420 probably null Het
Mei1 A G 15: 82,083,152 K310E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Ogdh T C 11: 6,342,601 V438A possibly damaging Het
Olfr1109 T A 2: 87,092,762 I212F probably benign Het
Olfr1293-ps T C 2: 111,527,955 Y232H probably damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Parp2 G A 14: 50,819,387 V323M probably benign Het
Pip5k1a A G 3: 95,072,003 S161P probably benign Het
Pomt1 G A 2: 32,245,619 V332I probably benign Het
Ppp2ca T A 11: 52,119,262 N232K probably damaging Het
Prune2 A T 19: 17,123,954 D2274V probably damaging Het
Pwwp2b G A 7: 139,256,034 V464I possibly damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rubcn A G 16: 32,829,259 probably null Het
Scai A T 2: 39,075,052 D593E probably benign Het
Slc24a2 T C 4: 87,176,185 T366A probably benign Het
Sp100 A G 1: 85,681,109 I320V probably benign Het
Syngr2 C A 11: 117,813,417 P206Q probably damaging Het
Tatdn3 A T 1: 191,046,324 probably null Het
Thsd7a C T 6: 12,555,226 G220S probably benign Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r11 C T 5: 109,053,394 A415T probably damaging Het
Vmn2r88 A G 14: 51,413,978 M258V probably benign Het
Wiz G A 17: 32,357,898 R561C probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Other mutations in Pold3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01891:Pold3 APN 7 100088145 splice site probably benign
IGL02101:Pold3 APN 7 100100496 missense probably damaging 0.99
IGL02402:Pold3 APN 7 100100411 splice site probably benign
IGL02541:Pold3 APN 7 100083672 missense probably damaging 1.00
IGL03145:Pold3 APN 7 100096512 missense probably damaging 1.00
R0522:Pold3 UTSW 7 100121383 missense probably damaging 1.00
R1263:Pold3 UTSW 7 100119683 missense possibly damaging 0.65
R1956:Pold3 UTSW 7 100088111 missense probably benign 0.03
R2508:Pold3 UTSW 7 100121383 missense probably damaging 1.00
R4135:Pold3 UTSW 7 100100647 nonsense probably null
R4354:Pold3 UTSW 7 100100617 missense possibly damaging 0.81
R5038:Pold3 UTSW 7 100121383 missense probably damaging 1.00
R6060:Pold3 UTSW 7 100100612 nonsense probably null
R6118:Pold3 UTSW 7 100096407 missense possibly damaging 0.88
R6338:Pold3 UTSW 7 100088105 missense possibly damaging 0.94
R6466:Pold3 UTSW 7 100100632 missense probably benign 0.01
R7000:Pold3 UTSW 7 100106658 missense probably damaging 1.00
R8088:Pold3 UTSW 7 100112301 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGTCGGCCAGTCTCAAC -3'
(R):5'- GCTGGCCTCTCACTAGTTTG -3'

Sequencing Primer
(F):5'- TCAACTGTCTTGAGGGGCCAC -3'
(R):5'- AGTTTGGCCCTCACCCG -3'
Posted On2015-04-17