Incidental Mutation 'R3933:Pwwp2b'
ID308558
Institutional Source Beutler Lab
Gene Symbol Pwwp2b
Ensembl Gene ENSMUSG00000060260
Gene NamePWWP domain containing 2B
SynonymsD930023J19Rik, Pwwp2, D7Ertd517e
MMRRC Submission 040920-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R3933 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location139248482-139269903 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 139256034 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 464 (V464I)
Ref Sequence ENSEMBL: ENSMUSP00000130888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093993] [ENSMUST00000172136]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093993
AA Change: V464I

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091529
Gene: ENSMUSG00000060260
AA Change: V464I

DomainStartEndE-ValueType
low complexity region 105 120 N/A INTRINSIC
low complexity region 145 165 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
low complexity region 305 319 N/A INTRINSIC
low complexity region 381 401 N/A INTRINSIC
low complexity region 457 468 N/A INTRINSIC
PDB:4LD6|A 485 506 4e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000172136
AA Change: V464I

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130888
Gene: ENSMUSG00000060260
AA Change: V464I

DomainStartEndE-ValueType
low complexity region 105 120 N/A INTRINSIC
low complexity region 145 165 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
low complexity region 305 319 N/A INTRINSIC
low complexity region 381 401 N/A INTRINSIC
low complexity region 457 468 N/A INTRINSIC
Pfam:PWWP 498 583 5.5e-19 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 96% (43/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,354,856 F3350L probably damaging Het
Acp6 T C 3: 97,166,183 V146A probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Arhgef33 A G 17: 80,373,320 I630V probably benign Het
Astn2 G A 4: 66,403,955 R136C unknown Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
C1rl T A 6: 124,508,822 L384* probably null Het
Ccdc130 G A 8: 84,260,352 A172V probably benign Het
Ccdc6 TCCGCCGCCGCC TCCGCCGCC 10: 70,189,170 probably benign Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ercc5 T A 1: 44,167,856 M643K probably benign Het
Fut8 A C 12: 77,475,259 K557N probably damaging Het
Hsdl2 T C 4: 59,597,274 Y88H probably damaging Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Itga8 A G 2: 12,189,519 I690T probably benign Het
Lepr T C 4: 101,765,301 probably benign Het
Matn2 T C 15: 34,345,420 probably null Het
Mei1 A G 15: 82,083,152 K310E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Ogdh T C 11: 6,342,601 V438A possibly damaging Het
Olfr1109 T A 2: 87,092,762 I212F probably benign Het
Olfr1293-ps T C 2: 111,527,955 Y232H probably damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Parp2 G A 14: 50,819,387 V323M probably benign Het
Pip5k1a A G 3: 95,072,003 S161P probably benign Het
Pold3 T C 7: 100,121,401 E8G probably damaging Het
Pomt1 G A 2: 32,245,619 V332I probably benign Het
Ppp2ca T A 11: 52,119,262 N232K probably damaging Het
Prune2 A T 19: 17,123,954 D2274V probably damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rubcn A G 16: 32,829,259 probably null Het
Scai A T 2: 39,075,052 D593E probably benign Het
Slc24a2 T C 4: 87,176,185 T366A probably benign Het
Sp100 A G 1: 85,681,109 I320V probably benign Het
Syngr2 C A 11: 117,813,417 P206Q probably damaging Het
Tatdn3 A T 1: 191,046,324 probably null Het
Thsd7a C T 6: 12,555,226 G220S probably benign Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r11 C T 5: 109,053,394 A415T probably damaging Het
Vmn2r88 A G 14: 51,413,978 M258V probably benign Het
Wiz G A 17: 32,357,898 R561C probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Other mutations in Pwwp2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Pwwp2b APN 7 139254855 nonsense probably null
IGL02209:Pwwp2b APN 7 139255105 missense probably damaging 1.00
IGL02938:Pwwp2b APN 7 139256143 missense probably damaging 1.00
Conservative UTSW 7 139255586 missense probably benign 0.09
Edgy UTSW 7 139256062 missense possibly damaging 0.90
R0033:Pwwp2b UTSW 7 139254928 missense possibly damaging 0.87
R0033:Pwwp2b UTSW 7 139254928 missense possibly damaging 0.87
R1491:Pwwp2b UTSW 7 139255963 missense probably damaging 1.00
R1636:Pwwp2b UTSW 7 139254842 missense probably benign 0.00
R1672:Pwwp2b UTSW 7 139254831 missense probably benign
R1793:Pwwp2b UTSW 7 139256365 missense probably damaging 0.97
R2016:Pwwp2b UTSW 7 139256151 missense possibly damaging 0.91
R2159:Pwwp2b UTSW 7 139254928 missense possibly damaging 0.87
R2228:Pwwp2b UTSW 7 139255188 missense probably damaging 1.00
R2229:Pwwp2b UTSW 7 139255188 missense probably damaging 1.00
R2380:Pwwp2b UTSW 7 139255450 missense probably damaging 1.00
R3023:Pwwp2b UTSW 7 139256194 missense probably damaging 1.00
R4440:Pwwp2b UTSW 7 139255639 missense probably benign 0.09
R4844:Pwwp2b UTSW 7 139255586 missense probably benign 0.09
R4873:Pwwp2b UTSW 7 139256062 missense possibly damaging 0.90
R4875:Pwwp2b UTSW 7 139256062 missense possibly damaging 0.90
R5022:Pwwp2b UTSW 7 139255578 missense possibly damaging 0.81
R5446:Pwwp2b UTSW 7 139255150 missense probably damaging 0.96
R5656:Pwwp2b UTSW 7 139255971 missense possibly damaging 0.93
R6465:Pwwp2b UTSW 7 139256035 missense probably benign 0.01
R6578:Pwwp2b UTSW 7 139256112 missense probably damaging 1.00
R6774:Pwwp2b UTSW 7 139255987 missense probably benign 0.13
R7218:Pwwp2b UTSW 7 139256133 missense probably damaging 1.00
R7316:Pwwp2b UTSW 7 139256224 missense probably benign 0.29
R7818:Pwwp2b UTSW 7 139255324 missense probably benign
R8249:Pwwp2b UTSW 7 139254843 missense probably damaging 0.99
R8319:Pwwp2b UTSW 7 139255183 missense probably damaging 0.99
X0017:Pwwp2b UTSW 7 139255806 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAGGTAAACATGGCCGTGATG -3'
(R):5'- AGACTTTCGCTTCTTGCCAAG -3'

Sequencing Primer
(F):5'- CCGTGATGGCTTGGCTTTTC -3'
(R):5'- TCTGGCCAAGGCTGATGTCAAG -3'
Posted On2015-04-17