Incidental Mutation 'R3933:Ccdc130'
ID308559
Institutional Source Beutler Lab
Gene Symbol Ccdc130
Ensembl Gene ENSMUSG00000004994
Gene Namecoiled-coil domain containing 130
Synonyms
MMRRC Submission 040920-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R3933 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location84257795-84270380 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84260352 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 172 (A172V)
Ref Sequence ENSEMBL: ENSMUSP00000096177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005120] [ENSMUST00000098578] [ENSMUST00000126435] [ENSMUST00000163993] [ENSMUST00000172320]
Predicted Effect probably benign
Transcript: ENSMUST00000005120
AA Change: A172V

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000005120
Gene: ENSMUSG00000004994
AA Change: A172V

DomainStartEndE-ValueType
Pfam:DUF572 1 198 1.7e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000005122
SMART Domains Protein: ENSMUSP00000005122
Gene: ENSMUSG00000004996

DomainStartEndE-ValueType
Pfam:IF-2B 40 152 9.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098578
AA Change: A172V

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000096177
Gene: ENSMUSG00000004994
AA Change: A172V

DomainStartEndE-ValueType
Pfam:DUF572 1 384 1.4e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125498
SMART Domains Protein: ENSMUSP00000117115
Gene: ENSMUSG00000004996

DomainStartEndE-ValueType
Pfam:IF-2B 2 226 5.9e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126435
SMART Domains Protein: ENSMUSP00000122623
Gene: ENSMUSG00000004996

DomainStartEndE-ValueType
Pfam:IF-2B 44 346 4.8e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127747
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140850
Predicted Effect probably benign
Transcript: ENSMUST00000163993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166728
Predicted Effect probably benign
Transcript: ENSMUST00000172320
SMART Domains Protein: ENSMUSP00000128605
Gene: ENSMUSG00000004994

DomainStartEndE-ValueType
Pfam:DUF572 1 68 1.4e-31 PFAM
Meta Mutation Damage Score 0.1200 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 96% (43/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,354,856 F3350L probably damaging Het
Acp6 T C 3: 97,166,183 V146A probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Arhgef33 A G 17: 80,373,320 I630V probably benign Het
Astn2 G A 4: 66,403,955 R136C unknown Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
C1rl T A 6: 124,508,822 L384* probably null Het
Ccdc6 TCCGCCGCCGCC TCCGCCGCC 10: 70,189,170 probably benign Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ercc5 T A 1: 44,167,856 M643K probably benign Het
Fut8 A C 12: 77,475,259 K557N probably damaging Het
Hsdl2 T C 4: 59,597,274 Y88H probably damaging Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Itga8 A G 2: 12,189,519 I690T probably benign Het
Lepr T C 4: 101,765,301 probably benign Het
Matn2 T C 15: 34,345,420 probably null Het
Mei1 A G 15: 82,083,152 K310E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Ogdh T C 11: 6,342,601 V438A possibly damaging Het
Olfr1109 T A 2: 87,092,762 I212F probably benign Het
Olfr1293-ps T C 2: 111,527,955 Y232H probably damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Parp2 G A 14: 50,819,387 V323M probably benign Het
Pip5k1a A G 3: 95,072,003 S161P probably benign Het
Pold3 T C 7: 100,121,401 E8G probably damaging Het
Pomt1 G A 2: 32,245,619 V332I probably benign Het
Ppp2ca T A 11: 52,119,262 N232K probably damaging Het
Prune2 A T 19: 17,123,954 D2274V probably damaging Het
Pwwp2b G A 7: 139,256,034 V464I possibly damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rubcn A G 16: 32,829,259 probably null Het
Scai A T 2: 39,075,052 D593E probably benign Het
Slc24a2 T C 4: 87,176,185 T366A probably benign Het
Sp100 A G 1: 85,681,109 I320V probably benign Het
Syngr2 C A 11: 117,813,417 P206Q probably damaging Het
Tatdn3 A T 1: 191,046,324 probably null Het
Thsd7a C T 6: 12,555,226 G220S probably benign Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r11 C T 5: 109,053,394 A415T probably damaging Het
Vmn2r88 A G 14: 51,413,978 M258V probably benign Het
Wiz G A 17: 32,357,898 R561C probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Other mutations in Ccdc130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Ccdc130 APN 8 84260534 splice site probably benign
IGL02536:Ccdc130 APN 8 84260616 nonsense probably null
IGL02810:Ccdc130 APN 8 84264368 splice site probably benign
R0350:Ccdc130 UTSW 8 84260648 missense probably damaging 1.00
R0567:Ccdc130 UTSW 8 84260665 missense probably damaging 1.00
R1807:Ccdc130 UTSW 8 84260307 missense probably damaging 1.00
R2209:Ccdc130 UTSW 8 84263869 missense probably benign 0.00
R3949:Ccdc130 UTSW 8 84258824 missense probably benign 0.03
R4633:Ccdc130 UTSW 8 84260395 missense probably benign 0.06
R4715:Ccdc130 UTSW 8 84263874 missense probably damaging 1.00
R4722:Ccdc130 UTSW 8 84258810 missense probably benign 0.00
R5001:Ccdc130 UTSW 8 84258675 missense probably benign 0.10
R5631:Ccdc130 UTSW 8 84263881 missense probably damaging 0.99
R5874:Ccdc130 UTSW 8 84258548 missense possibly damaging 0.92
R6434:Ccdc130 UTSW 8 84263001 missense probably damaging 1.00
R6467:Ccdc130 UTSW 8 84258689 missense probably benign
R7259:Ccdc130 UTSW 8 84260317 missense probably damaging 1.00
R7822:Ccdc130 UTSW 8 84261782 missense probably damaging 1.00
Z1088:Ccdc130 UTSW 8 84258909 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGTGCTGTACATAGGGAGC -3'
(R):5'- CTATGTCATCGTGAGTGGTGCC -3'

Sequencing Primer
(F):5'- TGCTGTACATAGGGAGCATGAAGC -3'
(R):5'- AGGTGCTGACCACAGGTG -3'
Posted On2015-04-17