Incidental Mutation 'R3933:Ccdc6'
ID308560
Institutional Source Beutler Lab
Gene Symbol Ccdc6
Ensembl Gene ENSMUSG00000048701
Gene Namecoiled-coil domain containing 6
Synonyms
MMRRC Submission 040920-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3933 (G1)
Quality Score217
Status Validated
Chromosome10
Chromosomal Location70097121-70193200 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) TCCGCCGCCGCC to TCCGCCGCC at 70189170 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000147545]
Predicted Effect probably benign
Transcript: ENSMUST00000135607
SMART Domains Protein: ENSMUSP00000116408
Gene: ENSMUSG00000048701

DomainStartEndE-ValueType
Pfam:DUF2046 1 43 1.1e-22 PFAM
low complexity region 57 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147545
SMART Domains Protein: ENSMUSP00000123374
Gene: ENSMUSG00000048701

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:DUF2046 25 330 2.2e-153 PFAM
low complexity region 344 361 N/A INTRINSIC
low complexity region 404 413 N/A INTRINSIC
low complexity region 419 469 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156001
SMART Domains Protein: ENSMUSP00000115678
Gene: ENSMUSG00000048701

DomainStartEndE-ValueType
Pfam:DUF2046 1 55 1.6e-27 PFAM
low complexity region 69 86 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein. The encoded protein is ubiquitously expressed and may function as a tumor suppressor. A chromosomal rearrangement resulting in the expression of a fusion gene containing a portion of this gene and the intracellular kinase-encoding domain of the ret proto-oncogene is the cause of thyroid papillary carcinoma.[provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,354,856 F3350L probably damaging Het
Acp6 T C 3: 97,166,183 V146A probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Arhgef33 A G 17: 80,373,320 I630V probably benign Het
Astn2 G A 4: 66,403,955 R136C unknown Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
C1rl T A 6: 124,508,822 L384* probably null Het
Ccdc130 G A 8: 84,260,352 A172V probably benign Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ercc5 T A 1: 44,167,856 M643K probably benign Het
Fut8 A C 12: 77,475,259 K557N probably damaging Het
Hsdl2 T C 4: 59,597,274 Y88H probably damaging Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Itga8 A G 2: 12,189,519 I690T probably benign Het
Lepr T C 4: 101,765,301 probably benign Het
Matn2 T C 15: 34,345,420 probably null Het
Mei1 A G 15: 82,083,152 K310E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Ogdh T C 11: 6,342,601 V438A possibly damaging Het
Olfr1109 T A 2: 87,092,762 I212F probably benign Het
Olfr1293-ps T C 2: 111,527,955 Y232H probably damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Parp2 G A 14: 50,819,387 V323M probably benign Het
Pip5k1a A G 3: 95,072,003 S161P probably benign Het
Pold3 T C 7: 100,121,401 E8G probably damaging Het
Pomt1 G A 2: 32,245,619 V332I probably benign Het
Ppp2ca T A 11: 52,119,262 N232K probably damaging Het
Prune2 A T 19: 17,123,954 D2274V probably damaging Het
Pwwp2b G A 7: 139,256,034 V464I possibly damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rubcn A G 16: 32,829,259 probably null Het
Scai A T 2: 39,075,052 D593E probably benign Het
Slc24a2 T C 4: 87,176,185 T366A probably benign Het
Sp100 A G 1: 85,681,109 I320V probably benign Het
Syngr2 C A 11: 117,813,417 P206Q probably damaging Het
Tatdn3 A T 1: 191,046,324 probably null Het
Thsd7a C T 6: 12,555,226 G220S probably benign Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r11 C T 5: 109,053,394 A415T probably damaging Het
Vmn2r88 A G 14: 51,413,978 M258V probably benign Het
Wiz G A 17: 32,357,898 R561C probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Other mutations in Ccdc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02034:Ccdc6 APN 10 70169148 missense probably benign 0.35
IGL03035:Ccdc6 APN 10 70182176 missense probably benign 0.32
R0455:Ccdc6 UTSW 10 70142571 splice site probably benign
R1102:Ccdc6 UTSW 10 70187806 missense possibly damaging 0.73
R1609:Ccdc6 UTSW 10 70167047 missense probably damaging 1.00
R1807:Ccdc6 UTSW 10 70175159 missense possibly damaging 0.83
R2513:Ccdc6 UTSW 10 70187828 splice site probably benign
R4684:Ccdc6 UTSW 10 70189256 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCAGGAACCACCGATGACAG -3'
(R):5'- AACGCGTCAGATCCAAGTAC -3'

Sequencing Primer
(F):5'- CCGATGACAGAGAAGGAGCCC -3'
(R):5'- TCAGATCCAAGTACGCCGG -3'
Posted On2015-04-17