Incidental Mutation 'R3933:Fut8'
ID308568
Institutional Source Beutler Lab
Gene Symbol Fut8
Ensembl Gene ENSMUSG00000021065
Gene Namefucosyltransferase 8
Synonymsalpha (1,6) fucosyltransferase
MMRRC Submission 040920-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3933 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location77238125-77476338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 77475259 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 557 (K557N)
Ref Sequence ENSEMBL: ENSMUSP00000136327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062804] [ENSMUST00000171770] [ENSMUST00000177595]
Predicted Effect probably damaging
Transcript: ENSMUST00000062804
AA Change: K557N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054530
Gene: ENSMUSG00000021065
AA Change: K557N

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
SH3 505 562 1.13e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171770
AA Change: K557N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130845
Gene: ENSMUSG00000021065
AA Change: K557N

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
SH3 505 562 1.13e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177595
AA Change: K557N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136327
Gene: ENSMUSG00000021065
AA Change: K557N

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
SH3 505 562 1.13e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219299
Meta Mutation Damage Score 0.8332 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme belonging to the family of fucosyltransferases. The product of this gene catalyzes the transfer of fucose from GDP-fucose to N-linked type complex glycopeptides. This enzyme is distinct from other fucosyltransferases which catalyze alpha1-2, alpha1-3, and alpha1-4 fucose addition. The expression of this gene may contribute to the malignancy of cancer cells and to their invasive and metastatic capabilities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous null mutation of this gene results in partial postnatal lethality, growth retardation, and progressive emphysema-like changes that include enlarged alveoli, increased lung capacity and compliance, and alveolar cell apoptosis. Postnatal survival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,354,856 F3350L probably damaging Het
Acp6 T C 3: 97,166,183 V146A probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Arhgef33 A G 17: 80,373,320 I630V probably benign Het
Astn2 G A 4: 66,403,955 R136C unknown Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
C1rl T A 6: 124,508,822 L384* probably null Het
Ccdc130 G A 8: 84,260,352 A172V probably benign Het
Ccdc6 TCCGCCGCCGCC TCCGCCGCC 10: 70,189,170 probably benign Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ercc5 T A 1: 44,167,856 M643K probably benign Het
Hsdl2 T C 4: 59,597,274 Y88H probably damaging Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Itga8 A G 2: 12,189,519 I690T probably benign Het
Lepr T C 4: 101,765,301 probably benign Het
Matn2 T C 15: 34,345,420 probably null Het
Mei1 A G 15: 82,083,152 K310E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Ogdh T C 11: 6,342,601 V438A possibly damaging Het
Olfr1109 T A 2: 87,092,762 I212F probably benign Het
Olfr1293-ps T C 2: 111,527,955 Y232H probably damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Parp2 G A 14: 50,819,387 V323M probably benign Het
Pip5k1a A G 3: 95,072,003 S161P probably benign Het
Pold3 T C 7: 100,121,401 E8G probably damaging Het
Pomt1 G A 2: 32,245,619 V332I probably benign Het
Ppp2ca T A 11: 52,119,262 N232K probably damaging Het
Prune2 A T 19: 17,123,954 D2274V probably damaging Het
Pwwp2b G A 7: 139,256,034 V464I possibly damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rubcn A G 16: 32,829,259 probably null Het
Scai A T 2: 39,075,052 D593E probably benign Het
Slc24a2 T C 4: 87,176,185 T366A probably benign Het
Sp100 A G 1: 85,681,109 I320V probably benign Het
Syngr2 C A 11: 117,813,417 P206Q probably damaging Het
Tatdn3 A T 1: 191,046,324 probably null Het
Thsd7a C T 6: 12,555,226 G220S probably benign Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r11 C T 5: 109,053,394 A415T probably damaging Het
Vmn2r88 A G 14: 51,413,978 M258V probably benign Het
Wiz G A 17: 32,357,898 R561C probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Other mutations in Fut8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Fut8 APN 12 77448488 missense probably benign
IGL00841:Fut8 APN 12 77365321 missense probably benign
IGL01660:Fut8 APN 12 77450258 nonsense probably null
IGL02330:Fut8 APN 12 77450243 missense probably damaging 1.00
IGL02815:Fut8 APN 12 77365083 missense probably benign
IGL02836:Fut8 APN 12 77450213 missense probably benign 0.24
IGL02981:Fut8 APN 12 77475038 missense probably damaging 1.00
IGL03328:Fut8 APN 12 77365229 missense probably damaging 0.99
Seaweed UTSW 12 77475315 makesense probably null
R0001:Fut8 UTSW 12 77475315 makesense probably null
R0037:Fut8 UTSW 12 77365037 missense probably benign
R0115:Fut8 UTSW 12 77448560 missense probably damaging 1.00
R0334:Fut8 UTSW 12 77393762 missense possibly damaging 0.95
R0481:Fut8 UTSW 12 77448560 missense probably damaging 1.00
R0554:Fut8 UTSW 12 77364970 missense probably benign 0.00
R0671:Fut8 UTSW 12 77475017 missense probably damaging 1.00
R1491:Fut8 UTSW 12 77448674 missense possibly damaging 0.50
R1918:Fut8 UTSW 12 77332218 missense probably benign 0.25
R2336:Fut8 UTSW 12 77412956 splice site probably benign
R2975:Fut8 UTSW 12 77365013 missense probably benign 0.20
R4066:Fut8 UTSW 12 77464061 missense probably damaging 1.00
R4067:Fut8 UTSW 12 77464061 missense probably damaging 1.00
R4159:Fut8 UTSW 12 77393749 missense probably damaging 0.98
R4728:Fut8 UTSW 12 77475199 missense probably damaging 1.00
R4768:Fut8 UTSW 12 77365280 missense probably benign 0.12
R4831:Fut8 UTSW 12 77393829 missense probably damaging 0.99
R4914:Fut8 UTSW 12 77475044 missense probably damaging 1.00
R4915:Fut8 UTSW 12 77475044 missense probably damaging 1.00
R4917:Fut8 UTSW 12 77475044 missense probably damaging 1.00
R4918:Fut8 UTSW 12 77475044 missense probably damaging 1.00
R5143:Fut8 UTSW 12 77365209 missense probably benign 0.07
R5234:Fut8 UTSW 12 77332230 missense probably benign 0.12
R5973:Fut8 UTSW 12 77364997 missense probably benign
R6103:Fut8 UTSW 12 77331947 start gained probably benign
R7167:Fut8 UTSW 12 77448632 missense possibly damaging 0.94
R7498:Fut8 UTSW 12 77412934 missense probably benign 0.00
R7536:Fut8 UTSW 12 77475078 missense probably damaging 1.00
X0065:Fut8 UTSW 12 77448521 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGACATCTACTATTTTGGAGGCC -3'
(R):5'- TAAAGAGGCGTTCCACCAGTG -3'

Sequencing Primer
(F):5'- CAAAATGCCCACAATCAGATTGCTG -3'
(R):5'- TTCCACCAGTGCAGCATCTGAG -3'
Posted On2015-04-17