Incidental Mutation 'R3933:Rgs7bp'
ID308569
Institutional Source Beutler Lab
Gene Symbol Rgs7bp
Ensembl Gene ENSMUSG00000021719
Gene Nameregulator of G-protein signalling 7 binding protein
SynonymsD13Bwg1146e, R7bp, A930030I01Rik
MMRRC Submission 040920-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3933 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location104945904-105054930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105052998 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 98 (M98V)
Ref Sequence ENSEMBL: ENSMUSP00000066614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063551]
Predicted Effect probably benign
Transcript: ENSMUST00000063551
AA Change: M98V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000066614
Gene: ENSMUSG00000021719
AA Change: M98V

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
coiled coil region 194 221 N/A INTRINSIC
Meta Mutation Damage Score 0.0585 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to all members of the R7 subfamily of regulators of G protein signaling and regulates their translocation between the nucleus and the plasma membrane. The encoded protein could be regulated by reversible palmitoylation, which anchors it to the plasma membrane. Depalmitoylation localizes the protein to the nucleus. Polymorphisms in this gene may be associated with risk of aspirin-exacerbated respiratory disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit normal behavior and brain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,354,856 F3350L probably damaging Het
Acp6 T C 3: 97,166,183 V146A probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Arhgef33 A G 17: 80,373,320 I630V probably benign Het
Astn2 G A 4: 66,403,955 R136C unknown Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
C1rl T A 6: 124,508,822 L384* probably null Het
Ccdc130 G A 8: 84,260,352 A172V probably benign Het
Ccdc6 TCCGCCGCCGCC TCCGCCGCC 10: 70,189,170 probably benign Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ercc5 T A 1: 44,167,856 M643K probably benign Het
Fut8 A C 12: 77,475,259 K557N probably damaging Het
Hsdl2 T C 4: 59,597,274 Y88H probably damaging Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Itga8 A G 2: 12,189,519 I690T probably benign Het
Lepr T C 4: 101,765,301 probably benign Het
Matn2 T C 15: 34,345,420 probably null Het
Mei1 A G 15: 82,083,152 K310E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Ogdh T C 11: 6,342,601 V438A possibly damaging Het
Olfr1109 T A 2: 87,092,762 I212F probably benign Het
Olfr1293-ps T C 2: 111,527,955 Y232H probably damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Parp2 G A 14: 50,819,387 V323M probably benign Het
Pip5k1a A G 3: 95,072,003 S161P probably benign Het
Pold3 T C 7: 100,121,401 E8G probably damaging Het
Pomt1 G A 2: 32,245,619 V332I probably benign Het
Ppp2ca T A 11: 52,119,262 N232K probably damaging Het
Prune2 A T 19: 17,123,954 D2274V probably damaging Het
Pwwp2b G A 7: 139,256,034 V464I possibly damaging Het
Rubcn A G 16: 32,829,259 probably null Het
Scai A T 2: 39,075,052 D593E probably benign Het
Slc24a2 T C 4: 87,176,185 T366A probably benign Het
Sp100 A G 1: 85,681,109 I320V probably benign Het
Syngr2 C A 11: 117,813,417 P206Q probably damaging Het
Tatdn3 A T 1: 191,046,324 probably null Het
Thsd7a C T 6: 12,555,226 G220S probably benign Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r11 C T 5: 109,053,394 A415T probably damaging Het
Vmn2r88 A G 14: 51,413,978 M258V probably benign Het
Wiz G A 17: 32,357,898 R561C probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Other mutations in Rgs7bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02117:Rgs7bp APN 13 104951579 missense possibly damaging 0.92
R0607:Rgs7bp UTSW 13 104967102 missense probably benign 0.02
R1938:Rgs7bp UTSW 13 104951582 missense probably damaging 1.00
R2151:Rgs7bp UTSW 13 104964089 missense probably damaging 1.00
R3932:Rgs7bp UTSW 13 105052998 missense probably benign 0.00
R4686:Rgs7bp UTSW 13 104964089 missense probably damaging 1.00
R4828:Rgs7bp UTSW 13 105053024 missense possibly damaging 0.59
R4944:Rgs7bp UTSW 13 104951564 missense probably benign 0.29
R7181:Rgs7bp UTSW 13 104982874 missense possibly damaging 0.85
R7786:Rgs7bp UTSW 13 105054060 missense probably benign 0.01
R8118:Rgs7bp UTSW 13 105053121 missense probably damaging 1.00
R8190:Rgs7bp UTSW 13 105053109 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTATATGATCTCACCCATCTGAG -3'
(R):5'- CCCAGAAGTCAGTGAAATCTCTG -3'

Sequencing Primer
(F):5'- TCTCACCCATCTGAGAATGATCGG -3'
(R):5'- CAGCTTGTCCAAGAGTTC -3'
Posted On2015-04-17