Incidental Mutation 'R3933:Parp2'
ID308570
Institutional Source Beutler Lab
Gene Symbol Parp2
Ensembl Gene ENSMUSG00000036023
Gene Namepoly (ADP-ribose) polymerase family, member 2
SynonymsPARP-2, Adprtl2, C78626, Aspartl2, Adprt2
MMRRC Submission 040920-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R3933 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50807841-50821301 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 50819387 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 323 (V323M)
Ref Sequence ENSEMBL: ENSMUSP00000048877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006444] [ENSMUST00000036126] [ENSMUST00000227810]
PDB Structure
CRYSTAL STRUCTURE OF THE CATALYTIC FRAGMENT OF MURINE POLY (ADP-RIBOSE) POLYMERASE-2 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000006444
SMART Domains Protein: ENSMUSP00000006444
Gene: ENSMUSG00000006281

DomainStartEndE-ValueType
Pfam:TEP1_N 1 29 2.8e-20 PFAM
Pfam:TEP1_N 31 59 1.4e-20 PFAM
Pfam:TEP1_N 61 89 3.1e-20 PFAM
Pfam:TEP1_N 91 119 3e-20 PFAM
low complexity region 195 207 N/A INTRINSIC
low complexity region 211 229 N/A INTRINSIC
Pfam:TROVE 230 685 3.2e-136 PFAM
Pfam:DUF4062 909 1020 2.4e-22 PFAM
Pfam:NACHT 1171 1346 9.2e-38 PFAM
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1622 1641 N/A INTRINSIC
WD40 1673 1711 2.98e-1 SMART
WD40 1714 1752 5.33e0 SMART
WD40 1755 1794 1.52e-4 SMART
WD40 1797 1835 3.27e-4 SMART
WD40 1838 1877 3.09e-1 SMART
WD40 1880 1919 2.24e-2 SMART
WD40 1925 1962 4.95e0 SMART
WD40 1968 2003 2.29e1 SMART
WD40 2008 2045 1.72e0 SMART
WD40 2058 2097 3.89e-11 SMART
WD40 2103 2142 3.93e-7 SMART
WD40 2145 2182 4.38e-5 SMART
WD40 2184 2232 1.24e0 SMART
WD40 2235 2273 1.14e-3 SMART
WD40 2275 2315 4.46e-1 SMART
Blast:WD40 2316 2353 4e-12 BLAST
WD40 2546 2583 6.79e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036126
AA Change: V323M

PolyPhen 2 Score 0.438 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048877
Gene: ENSMUSG00000036023
AA Change: V323M

DomainStartEndE-ValueType
WGR 95 175 1.17e-35 SMART
Pfam:PARP_reg 208 338 1.4e-49 PFAM
Pfam:PARP 341 553 1.8e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226222
Predicted Effect probably benign
Transcript: ENSMUST00000226430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226880
Predicted Effect probably benign
Transcript: ENSMUST00000227810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228872
Meta Mutation Damage Score 0.2280 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes poly(ADP-ribosyl)transferase-like 2 protein, which contains a catalytic domain and is capable of catalyzing a poly(ADP-ribosyl)ation reaction. This protein has a catalytic domain which is homologous to that of poly (ADP-ribosyl) transferase, but lacks an N-terminal DNA binding domain which activates the C-terminal catalytic domain of poly (ADP-ribosyl) transferase. The basic residues within the N-terminal region of this protein may bear potential DNA-binding properties, and may be involved in the nuclear and/or nucleolar targeting of the protein. Two alternatively spliced transcript variants encoding distinct isoforms have been found. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant animals are sensitive to gamma radiation. Epithelial crypt degeneration and DNA repair deficiency is apparent following radiation-induced injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,354,856 F3350L probably damaging Het
Acp6 T C 3: 97,166,183 V146A probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Arhgef33 A G 17: 80,373,320 I630V probably benign Het
Astn2 G A 4: 66,403,955 R136C unknown Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
C1rl T A 6: 124,508,822 L384* probably null Het
Ccdc130 G A 8: 84,260,352 A172V probably benign Het
Ccdc6 TCCGCCGCCGCC TCCGCCGCC 10: 70,189,170 probably benign Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ercc5 T A 1: 44,167,856 M643K probably benign Het
Fut8 A C 12: 77,475,259 K557N probably damaging Het
Hsdl2 T C 4: 59,597,274 Y88H probably damaging Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Itga8 A G 2: 12,189,519 I690T probably benign Het
Lepr T C 4: 101,765,301 probably benign Het
Matn2 T C 15: 34,345,420 probably null Het
Mei1 A G 15: 82,083,152 K310E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Ogdh T C 11: 6,342,601 V438A possibly damaging Het
Olfr1109 T A 2: 87,092,762 I212F probably benign Het
Olfr1293-ps T C 2: 111,527,955 Y232H probably damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Pip5k1a A G 3: 95,072,003 S161P probably benign Het
Pold3 T C 7: 100,121,401 E8G probably damaging Het
Pomt1 G A 2: 32,245,619 V332I probably benign Het
Ppp2ca T A 11: 52,119,262 N232K probably damaging Het
Prune2 A T 19: 17,123,954 D2274V probably damaging Het
Pwwp2b G A 7: 139,256,034 V464I possibly damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rubcn A G 16: 32,829,259 probably null Het
Scai A T 2: 39,075,052 D593E probably benign Het
Slc24a2 T C 4: 87,176,185 T366A probably benign Het
Sp100 A G 1: 85,681,109 I320V probably benign Het
Syngr2 C A 11: 117,813,417 P206Q probably damaging Het
Tatdn3 A T 1: 191,046,324 probably null Het
Thsd7a C T 6: 12,555,226 G220S probably benign Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r11 C T 5: 109,053,394 A415T probably damaging Het
Vmn2r88 A G 14: 51,413,978 M258V probably benign Het
Wiz G A 17: 32,357,898 R561C probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Other mutations in Parp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02826:Parp2 APN 14 50815415 missense probably benign 0.04
IGL03022:Parp2 APN 14 50821096 missense probably damaging 0.99
IGL03051:Parp2 APN 14 50819348 splice site probably benign
R0110:Parp2 UTSW 14 50819673 missense probably damaging 1.00
R0450:Parp2 UTSW 14 50819673 missense probably damaging 1.00
R0510:Parp2 UTSW 14 50819673 missense probably damaging 1.00
R1442:Parp2 UTSW 14 50819275 critical splice donor site probably null
R1590:Parp2 UTSW 14 50810544 missense probably benign 0.19
R1668:Parp2 UTSW 14 50820856 missense probably benign 0.00
R1806:Parp2 UTSW 14 50819379 missense probably damaging 0.99
R1846:Parp2 UTSW 14 50815386 nonsense probably null
R2029:Parp2 UTSW 14 50810086 missense probably benign 0.14
R2990:Parp2 UTSW 14 50817000 missense probably benign
R4921:Parp2 UTSW 14 50819268 missense probably damaging 0.99
R6406:Parp2 UTSW 14 50819477 missense probably benign
R6799:Parp2 UTSW 14 50821096 missense probably damaging 0.99
R7105:Parp2 UTSW 14 50810064 frame shift probably null
R7250:Parp2 UTSW 14 50817344 missense probably benign
R7606:Parp2 UTSW 14 50820030 missense probably damaging 1.00
RF002:Parp2 UTSW 14 50817386 missense probably damaging 1.00
X0019:Parp2 UTSW 14 50817099 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTGCTCACTGTGCTTGTATC -3'
(R):5'- AAGCTGGCAGAACTTTCCGTC -3'

Sequencing Primer
(F):5'- GTGCTTGTATCTCTGTCCTTAGAC -3'
(R):5'- GCAGAACTTTCCGTCCCCAG -3'
Posted On2015-04-17