Incidental Mutation 'R3933:Opa1'
ID308574
Institutional Source Beutler Lab
Gene Symbol Opa1
Ensembl Gene ENSMUSG00000038084
Gene NameOPA1, mitochondrial dynamin like GTPase
Synonyms1200011N24Rik, lilr3
MMRRC Submission 040920-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3933 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location29579334-29654884 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29610880 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 401 (E401D)
Ref Sequence ENSEMBL: ENSMUSP00000123880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038867] [ENSMUST00000160475] [ENSMUST00000160597] [ENSMUST00000161186]
Predicted Effect probably damaging
Transcript: ENSMUST00000038867
AA Change: E382D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036993
Gene: ENSMUSG00000038084
AA Change: E382D

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
low complexity region 189 205 N/A INTRINSIC
coiled coil region 228 271 N/A INTRINSIC
DYNc 283 533 2.18e-10 SMART
coiled coil region 918 967 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160153
Predicted Effect probably damaging
Transcript: ENSMUST00000160475
AA Change: E382D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124739
Gene: ENSMUSG00000038084
AA Change: E382D

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
low complexity region 189 205 N/A INTRINSIC
coiled coil region 228 271 N/A INTRINSIC
DYNc 283 533 2.18e-10 SMART
Blast:DYNc 608 632 1e-5 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000160597
AA Change: E364D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124223
Gene: ENSMUSG00000038084
AA Change: E364D

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
coiled coil region 210 253 N/A INTRINSIC
DYNc 265 515 2.18e-10 SMART
coiled coil region 900 949 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161186
AA Change: E401D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123880
Gene: ENSMUSG00000038084
AA Change: E401D

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
coiled coil region 207 290 N/A INTRINSIC
DYNc 302 552 2.18e-10 SMART
coiled coil region 937 986 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162240
AA Change: E287D
SMART Domains Protein: ENSMUSP00000124029
Gene: ENSMUSG00000038084
AA Change: E287D

DomainStartEndE-ValueType
low complexity region 58 74 N/A INTRINSIC
coiled coil region 93 176 N/A INTRINSIC
Pfam:Dynamin_N 215 296 5.7e-18 PFAM
Meta Mutation Damage Score 0.2434 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a nuclear-encoded mitochondrial protein with similarity to dynamin-related GTPases. It is a component of the mitochondrial network. Mutations in this gene have been associated with optic atrophy type 1, which is a dominantly inherited optic neuropathy resulting in progressive loss of visual acuity, leading in many cases to legal blindness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit embryonic lethality, embryonic growth retardation and morphological abnormalities. Mice heterozygous for an ENU mutation exhibit abnormal cellular morphology, altered optic nerve myelination, abnormal responseto a new environment and decreased vision. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,354,856 F3350L probably damaging Het
Acp6 T C 3: 97,166,183 V146A probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Arhgef33 A G 17: 80,373,320 I630V probably benign Het
Astn2 G A 4: 66,403,955 R136C unknown Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
C1rl T A 6: 124,508,822 L384* probably null Het
Ccdc130 G A 8: 84,260,352 A172V probably benign Het
Ccdc6 TCCGCCGCCGCC TCCGCCGCC 10: 70,189,170 probably benign Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ercc5 T A 1: 44,167,856 M643K probably benign Het
Fut8 A C 12: 77,475,259 K557N probably damaging Het
Hsdl2 T C 4: 59,597,274 Y88H probably damaging Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Itga8 A G 2: 12,189,519 I690T probably benign Het
Lepr T C 4: 101,765,301 probably benign Het
Matn2 T C 15: 34,345,420 probably null Het
Mei1 A G 15: 82,083,152 K310E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Ogdh T C 11: 6,342,601 V438A possibly damaging Het
Olfr1109 T A 2: 87,092,762 I212F probably benign Het
Olfr1293-ps T C 2: 111,527,955 Y232H probably damaging Het
Parp2 G A 14: 50,819,387 V323M probably benign Het
Pip5k1a A G 3: 95,072,003 S161P probably benign Het
Pold3 T C 7: 100,121,401 E8G probably damaging Het
Pomt1 G A 2: 32,245,619 V332I probably benign Het
Ppp2ca T A 11: 52,119,262 N232K probably damaging Het
Prune2 A T 19: 17,123,954 D2274V probably damaging Het
Pwwp2b G A 7: 139,256,034 V464I possibly damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rubcn A G 16: 32,829,259 probably null Het
Scai A T 2: 39,075,052 D593E probably benign Het
Slc24a2 T C 4: 87,176,185 T366A probably benign Het
Sp100 A G 1: 85,681,109 I320V probably benign Het
Syngr2 C A 11: 117,813,417 P206Q probably damaging Het
Tatdn3 A T 1: 191,046,324 probably null Het
Thsd7a C T 6: 12,555,226 G220S probably benign Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r11 C T 5: 109,053,394 A415T probably damaging Het
Vmn2r88 A G 14: 51,413,978 M258V probably benign Het
Wiz G A 17: 32,357,898 R561C probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Other mutations in Opa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Opa1 APN 16 29618115 splice site probably benign
IGL01087:Opa1 APN 16 29586997 missense probably damaging 1.00
IGL01799:Opa1 APN 16 29616658 missense possibly damaging 0.61
IGL01927:Opa1 APN 16 29586995 missense probably benign 0.35
IGL02067:Opa1 APN 16 29616655 missense probably damaging 1.00
IGL02317:Opa1 APN 16 29615166 critical splice donor site probably null
IGL02567:Opa1 APN 16 29588286 missense probably benign 0.01
IGL02826:Opa1 APN 16 29610887 missense probably null
Longshanks UTSW 16 29618259 missense probably damaging 1.00
R0032:Opa1 UTSW 16 29615069 missense probably damaging 1.00
R0032:Opa1 UTSW 16 29615069 missense probably damaging 1.00
R0092:Opa1 UTSW 16 29625594 missense probably damaging 0.99
R0114:Opa1 UTSW 16 29629635 missense probably benign 0.35
R0200:Opa1 UTSW 16 29614129 missense probably benign 0.08
R0308:Opa1 UTSW 16 29621531 missense probably damaging 0.98
R0427:Opa1 UTSW 16 29611461 missense probably damaging 0.98
R0671:Opa1 UTSW 16 29602207 splice site probably benign
R1768:Opa1 UTSW 16 29620810 missense probably benign
R1889:Opa1 UTSW 16 29625585 missense possibly damaging 0.67
R3932:Opa1 UTSW 16 29610880 missense probably damaging 1.00
R4434:Opa1 UTSW 16 29611983 missense probably damaging 1.00
R4618:Opa1 UTSW 16 29587039 missense probably damaging 1.00
R4926:Opa1 UTSW 16 29648973 missense possibly damaging 0.94
R5163:Opa1 UTSW 16 29597620 missense probably damaging 0.99
R5249:Opa1 UTSW 16 29618259 missense probably damaging 1.00
R5266:Opa1 UTSW 16 29618130 missense probably benign 0.19
R5275:Opa1 UTSW 16 29611579 missense probably damaging 1.00
R5372:Opa1 UTSW 16 29586119 missense probably benign 0.00
R5990:Opa1 UTSW 16 29587018 missense probably damaging 0.99
R6054:Opa1 UTSW 16 29615134 missense probably damaging 1.00
R6483:Opa1 UTSW 16 29628707 missense possibly damaging 0.72
R6522:Opa1 UTSW 16 29625514 missense probably benign 0.06
R6889:Opa1 UTSW 16 29620868 missense probably benign 0.22
R7225:Opa1 UTSW 16 29614039 splice site probably null
R7243:Opa1 UTSW 16 29586996 missense probably benign 0.01
R7324:Opa1 UTSW 16 29586981 missense probably benign
R7831:Opa1 UTSW 16 29648937 missense probably benign 0.02
R8304:Opa1 UTSW 16 29597671 missense possibly damaging 0.80
R8317:Opa1 UTSW 16 29614144 missense probably damaging 1.00
R8353:Opa1 UTSW 16 29620868 missense probably damaging 0.99
R8453:Opa1 UTSW 16 29620868 missense probably damaging 0.99
RF012:Opa1 UTSW 16 29613966 missense probably damaging 1.00
T0722:Opa1 UTSW 16 29610930 critical splice donor site probably null
X0065:Opa1 UTSW 16 29620784 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TAGCTCTCGGGAATTTGATCTC -3'
(R):5'- ACCCCACAATGATGTTTGGAAC -3'

Sequencing Primer
(F):5'- CTCGGGAATTTGATCTCACCAAGG -3'
(R):5'- GAATTGCTGGCCTTACCT -3'
Posted On2015-04-17