Incidental Mutation 'R3933:Msl3'
ID308579
Institutional Source Beutler Lab
Gene Symbol Msl3
Ensembl Gene ENSMUSG00000031358
Gene NameMSL complex subunit 3
SynonymsMsl31, Msl3l1
MMRRC Submission 040920-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock #R3933 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location168654117-168673898 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 168671817 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 87 (A87T)
Ref Sequence ENSEMBL: ENSMUSP00000033725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033725] [ENSMUST00000112137]
Predicted Effect probably damaging
Transcript: ENSMUST00000033725
AA Change: A87T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033725
Gene: ENSMUSG00000031358
AA Change: A87T

DomainStartEndE-ValueType
CHROMO 32 90 2.08e-5 SMART
Pfam:MRG 155 506 1.3e-66 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112137
AA Change: A28T

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107765
Gene: ENSMUSG00000031358
AA Change: A28T

DomainStartEndE-ValueType
Blast:CHROMO 3 31 2e-11 BLAST
PDB:3OA6|B 3 42 6e-16 PDB
Pfam:MRG 47 449 7.7e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129860
Meta Mutation Damage Score 0.2681 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is similar to the product of the Drosophila male-specific lethal-3 gene. The Drosophila protein plays a critical role in a dosage-compensation pathway, which equalizes X-linked gene expression in males and females. Thus, the human protein is thought to play a similar function in chromatin remodeling and transcriptional regulation, and it has been found as part of a complex that is responsible for histone H4 lysine-16 acetylation. This gene can undergo X inactivation. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 2, 7 and 8. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,354,856 F3350L probably damaging Het
Acp6 T C 3: 97,166,183 V146A probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Arhgef33 A G 17: 80,373,320 I630V probably benign Het
Astn2 G A 4: 66,403,955 R136C unknown Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
C1rl T A 6: 124,508,822 L384* probably null Het
Ccdc130 G A 8: 84,260,352 A172V probably benign Het
Ccdc6 TCCGCCGCCGCC TCCGCCGCC 10: 70,189,170 probably benign Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ercc5 T A 1: 44,167,856 M643K probably benign Het
Fut8 A C 12: 77,475,259 K557N probably damaging Het
Hsdl2 T C 4: 59,597,274 Y88H probably damaging Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Itga8 A G 2: 12,189,519 I690T probably benign Het
Lepr T C 4: 101,765,301 probably benign Het
Matn2 T C 15: 34,345,420 probably null Het
Mei1 A G 15: 82,083,152 K310E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ogdh T C 11: 6,342,601 V438A possibly damaging Het
Olfr1109 T A 2: 87,092,762 I212F probably benign Het
Olfr1293-ps T C 2: 111,527,955 Y232H probably damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Parp2 G A 14: 50,819,387 V323M probably benign Het
Pip5k1a A G 3: 95,072,003 S161P probably benign Het
Pold3 T C 7: 100,121,401 E8G probably damaging Het
Pomt1 G A 2: 32,245,619 V332I probably benign Het
Ppp2ca T A 11: 52,119,262 N232K probably damaging Het
Prune2 A T 19: 17,123,954 D2274V probably damaging Het
Pwwp2b G A 7: 139,256,034 V464I possibly damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rubcn A G 16: 32,829,259 probably null Het
Scai A T 2: 39,075,052 D593E probably benign Het
Slc24a2 T C 4: 87,176,185 T366A probably benign Het
Sp100 A G 1: 85,681,109 I320V probably benign Het
Syngr2 C A 11: 117,813,417 P206Q probably damaging Het
Tatdn3 A T 1: 191,046,324 probably null Het
Thsd7a C T 6: 12,555,226 G220S probably benign Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r11 C T 5: 109,053,394 A415T probably damaging Het
Vmn2r88 A G 14: 51,413,978 M258V probably benign Het
Wiz G A 17: 32,357,898 R561C probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Other mutations in Msl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Msl3 APN X 168668748 missense probably damaging 1.00
IGL02024:Msl3 APN X 168670251 missense probably benign 0.00
R3932:Msl3 UTSW X 168671817 missense probably damaging 0.99
R4214:Msl3 UTSW X 168662434 missense probably damaging 1.00
R4214:Msl3 UTSW X 168667063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGATTCCCCACTACCAAG -3'
(R):5'- TCTAAAATGTCAGCAAGTCTGGG -3'

Sequencing Primer
(F):5'- CTACCAAGTGGAAAACAGTTATTCTG -3'
(R):5'- AGCAAGTCTGGGGCACTTCTTC -3'
Posted On2015-04-17