Mutagenetix > Incidental Mutations

Incidental Mutation 'R3933:Msl3'

308579

Institutional Source

Beutler Lab

Gene Symbol

Msl3

Ensembl Gene

ENSMUSG00000031358

Gene Name

MSL complex subunit 3

Synonyms

Msl31, Msl3l1

MMRRC Submission

040920-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.303) question?

Stock #

R3933 (G1)

Quality Score

222

Status

Validated

Chromosome

Chromosomal Location

168654117-168673898 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 168671817 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 87 (A87T)

Ref Sequence

ENSEMBL: ENSMUSP00000033725 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033725] [ENSMUST00000112137]

Predicted Effect

probably damaging
Transcript: ENSMUST00000033725
AA Change: A87T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000033725
Gene: ENSMUSG00000031358
AA Change: A87T

Domain	Start	End	E-Value	Type
CHROMO	32	90	2.08e-5	SMART
Pfam:MRG	155	506	1.3e-66	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112137
AA Change: A28T

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000107765
Gene: ENSMUSG00000031358
AA Change: A28T

Domain	Start	End	E-Value	Type
Blast:CHROMO	3	31	2e-11	BLAST
PDB:3OA6\|B	3	42	6e-16	PDB
Pfam:MRG	47	449	7.7e-72	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129860

Meta Mutation Damage Score

0.2681

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.1%
20x: 94.1%

Validation Efficiency

96% (43/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is similar to the product of the Drosophila male-specific lethal-3 gene. The Drosophila protein plays a critical role in a dosage-compensation pathway, which equalizes X-linked gene expression in males and females. Thus, the human protein is thought to play a similar function in chromatin remodeling and transcriptional regulation, and it has been found as part of a complex that is responsible for histone H4 lysine-16 acetylation. This gene can undergo X inactivation. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 2, 7 and 8. [provided by RefSeq, Jul 2010]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,354,856	F3350L	probably damaging	Het
Acp6	T	C	3: 97,166,183	V146A	probably benign	Het
Ap3b2	C	T	7: 81,473,850		probably benign	Het
Arhgef33	A	G	17: 80,373,320	I630V	probably benign	Het
Astn2	G	A	4: 66,403,955	R136C	unknown	Het
Bcl2l14	A	G	6: 134,423,808	D64G	probably damaging	Het
C1rl	T	A	6: 124,508,822	L384*	probably null	Het
Ccdc130	G	A	8: 84,260,352	A172V	probably benign	Het
Ccdc6	TCCGCCGCCGCC	TCCGCCGCC	10: 70,189,170		probably benign	Het
Coch	T	C	12: 51,603,338	I370T	probably damaging	Het
Ercc5	T	A	1: 44,167,856	M643K	probably benign	Het
Fut8	A	C	12: 77,475,259	K557N	probably damaging	Het
Hsdl2	T	C	4: 59,597,274	Y88H	probably damaging	Het
Hspg2	T	C	4: 137,515,568	V670A	probably damaging	Het
Itga8	A	G	2: 12,189,519	I690T	probably benign	Het
Lepr	T	C	4: 101,765,301		probably benign	Het
Matn2	T	C	15: 34,345,420		probably null	Het
Mei1	A	G	15: 82,083,152	K310E	possibly damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Ogdh	T	C	11: 6,342,601	V438A	possibly damaging	Het
Olfr1109	T	A	2: 87,092,762	I212F	probably benign	Het
Olfr1293-ps	T	C	2: 111,527,955	Y232H	probably damaging	Het
Opa1	A	T	16: 29,610,880	E401D	probably damaging	Het
Parp2	G	A	14: 50,819,387	V323M	probably benign	Het
Pip5k1a	A	G	3: 95,072,003	S161P	probably benign	Het
Pold3	T	C	7: 100,121,401	E8G	probably damaging	Het
Pomt1	G	A	2: 32,245,619	V332I	probably benign	Het
Ppp2ca	T	A	11: 52,119,262	N232K	probably damaging	Het
Prune2	A	T	19: 17,123,954	D2274V	probably damaging	Het
Pwwp2b	G	A	7: 139,256,034	V464I	possibly damaging	Het
Rgs7bp	T	C	13: 105,052,998	M98V	probably benign	Het
Rubcn	A	G	16: 32,829,259		probably null	Het
Scai	A	T	2: 39,075,052	D593E	probably benign	Het
Slc24a2	T	C	4: 87,176,185	T366A	probably benign	Het
Sp100	A	G	1: 85,681,109	I320V	probably benign	Het
Syngr2	C	A	11: 117,813,417	P206Q	probably damaging	Het
Tatdn3	A	T	1: 191,046,324		probably null	Het
Thsd7a	C	T	6: 12,555,226	G220S	probably benign	Het
Tmem28	G	A	X: 99,821,864	V266M	possibly damaging	Het
Vmn2r10	C	A	5: 109,002,222	A319S	possibly damaging	Het
Vmn2r11	C	T	5: 109,053,394	A415T	probably damaging	Het
Vmn2r88	A	G	14: 51,413,978	M258V	probably benign	Het
Wiz	G	A	17: 32,357,898	R561C	probably damaging	Het
Zfp422	T	C	6: 116,626,459	K193R	probably benign	Het

Other mutations in Msl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00769:Msl3	APN	X	168668748	missense	probably damaging	1.00
IGL02024:Msl3	APN	X	168670251	missense	probably benign	0.00
R3932:Msl3	UTSW	X	168671817	missense	probably damaging	0.99
R4214:Msl3	UTSW	X	168662434	missense	probably damaging	1.00
R4214:Msl3	UTSW	X	168667063	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTGATTCCCCACTACCAAG -3'
(R):5'- TCTAAAATGTCAGCAAGTCTGGG -3'

Sequencing Primer
(F):5'- CTACCAAGTGGAAAACAGTTATTCTG -3'
(R):5'- AGCAAGTCTGGGGCACTTCTTC -3'

Posted On

2015-04-17