Incidental Mutation 'R3939:Vil1'
ID 308580
Institutional Source Beutler Lab
Gene Symbol Vil1
Ensembl Gene ENSMUSG00000026175
Gene Name villin 1
Synonyms
MMRRC Submission 040826-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.299) question?
Stock # R3939 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 74409376-74435559 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74432415 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 785 (D785G)
Ref Sequence ENSEMBL: ENSMUSP00000027366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027366] [ENSMUST00000044260]
AlphaFold Q62468
Predicted Effect probably benign
Transcript: ENSMUST00000027366
AA Change: D785G

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000027366
Gene: ENSMUSG00000026175
AA Change: D785G

DomainStartEndE-ValueType
GEL 17 114 2.93e-29 SMART
GEL 135 229 1.33e-18 SMART
GEL 251 349 5.85e-29 SMART
GEL 398 495 1.44e-28 SMART
GEL 515 601 7.31e-30 SMART
GEL 620 714 1.36e-29 SMART
VHP 792 827 1.77e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044260
SMART Domains Protein: ENSMUSP00000035445
Gene: ENSMUSG00000033364

DomainStartEndE-ValueType
Pfam:UCH_N 1 105 5.1e-47 PFAM
low complexity region 182 200 N/A INTRINSIC
Pfam:UCH_1 341 645 3.4e-16 PFAM
UIM 704 723 1.33e1 SMART
UIM 806 825 1.04e-1 SMART
UIM 828 847 2.11e-2 SMART
low complexity region 893 909 N/A INTRINSIC
Meta Mutation Damage Score 0.2887 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
MGI Phenotype Strain: 1859841
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of calcium-regulated actin-binding proteins. This protein represents a dominant part of the brush border cytoskeleton which functions in the capping, severing, and bundling of actin filaments. Two mRNAs of 2.7 kb and 3.5 kb have been observed; they result from utilization of alternate poly-adenylation signals present in the terminal exon. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants do not exhibit gross abnormalities or apparent defects of microvilli morphogenesis, however in one line, an increased sensitivity to colitis induced by dextran sulfate was observed. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(4) Gene trapped(4)          
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Cacnb4 C A 2: 52,469,489 R169L probably damaging Het
Col13a1 T C 10: 61,863,082 I491V unknown Het
Corin T C 5: 72,339,879 D531G possibly damaging Het
Cx3cr1 C T 9: 120,051,644 V231I probably benign Het
Dennd4c T G 4: 86,774,280 V9G probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Faf1 T G 4: 109,861,879 L394R probably damaging Het
Fgfr4 G A 13: 55,156,494 D116N probably null Het
Flt3 A G 5: 147,356,243 Y518H possibly damaging Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Gk2 T A 5: 97,455,352 L542F possibly damaging Het
Gm4922 T A 10: 18,784,614 E120V probably damaging Het
Hip1 A T 5: 135,428,764 I285N probably benign Het
Kcnd2 C A 6: 21,217,096 D266E probably damaging Het
Kdr C T 5: 75,972,429 W63* probably null Het
Kit A G 5: 75,609,318 D130G probably benign Het
Megf8 G A 7: 25,359,202 V2208I probably benign Het
Neto2 G A 8: 85,674,118 T16I probably damaging Het
Nktr T A 9: 121,749,069 probably benign Het
Nrxn1 A G 17: 90,208,421 I1207T probably damaging Het
Obox7 G A 7: 14,664,047 G4D probably benign Het
Ogdh G A 11: 6,350,655 W827* probably null Het
Olfr1223 T A 2: 89,144,130 K298* probably null Het
Olfr309 T C 7: 86,306,229 M295V probably benign Het
Olfr726 A G 14: 50,083,716 *322Q probably null Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sbpl T A 17: 23,953,643 I101L probably benign Het
Serpina9 T A 12: 104,008,892 M1L probably benign Het
Stxbp6 A G 12: 44,902,858 probably null Het
Synpo2 A G 3: 123,114,590 V359A probably damaging Het
Ttyh1 T A 7: 4,129,318 L155H probably damaging Het
Zfp345 G A 2: 150,472,553 H355Y probably damaging Het
Other mutations in Vil1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Vil1 APN 1 74423875 missense probably damaging 1.00
IGL00703:Vil1 APN 1 74423960 missense possibly damaging 0.61
IGL01011:Vil1 APN 1 74434887 splice site probably null
IGL01314:Vil1 APN 1 74428238 missense probably damaging 1.00
IGL01772:Vil1 APN 1 74415119 missense probably benign
IGL02378:Vil1 APN 1 74430691 splice site probably null
IGL02517:Vil1 APN 1 74426692 missense probably benign 0.43
IGL02955:Vil1 APN 1 74418523 missense probably benign 0.10
IGL03036:Vil1 APN 1 74419612 missense probably damaging 1.00
PIT4362001:Vil1 UTSW 1 74421383 missense probably damaging 1.00
R0104:Vil1 UTSW 1 74418366 missense probably benign 0.44
R0241:Vil1 UTSW 1 74426694 missense probably damaging 1.00
R0241:Vil1 UTSW 1 74426694 missense probably damaging 1.00
R0496:Vil1 UTSW 1 74421340 missense possibly damaging 0.88
R1329:Vil1 UTSW 1 74427558 missense probably benign 0.00
R1824:Vil1 UTSW 1 74418447 missense probably benign 0.00
R1916:Vil1 UTSW 1 74418525 missense probably benign
R2188:Vil1 UTSW 1 74427565 missense probably benign 0.22
R2216:Vil1 UTSW 1 74425679 missense probably benign 0.05
R3808:Vil1 UTSW 1 74427613 missense probably benign
R4288:Vil1 UTSW 1 74418525 missense probably benign
R4648:Vil1 UTSW 1 74432298 missense probably benign
R4748:Vil1 UTSW 1 74421266 missense probably damaging 1.00
R5333:Vil1 UTSW 1 74432390 missense probably benign
R5429:Vil1 UTSW 1 74432331 missense probably benign 0.05
R5973:Vil1 UTSW 1 74416033 missense possibly damaging 0.93
R6007:Vil1 UTSW 1 74419867 missense probably damaging 1.00
R6247:Vil1 UTSW 1 74432339 missense probably benign
R6306:Vil1 UTSW 1 74421311 missense possibly damaging 0.90
R6989:Vil1 UTSW 1 74423954 missense probably damaging 0.99
R7112:Vil1 UTSW 1 74416002 missense probably damaging 1.00
R7320:Vil1 UTSW 1 74418444 missense probably damaging 1.00
R7481:Vil1 UTSW 1 74419899 missense probably damaging 1.00
R7553:Vil1 UTSW 1 74426732 critical splice donor site probably null
R7709:Vil1 UTSW 1 74426595 missense probably benign 0.39
R7791:Vil1 UTSW 1 74428136 missense probably damaging 1.00
R8159:Vil1 UTSW 1 74423977 missense probably benign 0.00
R8190:Vil1 UTSW 1 74434893 nonsense probably null
R9650:Vil1 UTSW 1 74425616 missense probably benign 0.32
R9679:Vil1 UTSW 1 74430674 missense probably benign 0.00
R9734:Vil1 UTSW 1 74415150 missense possibly damaging 0.46
Z1176:Vil1 UTSW 1 74428232 missense probably damaging 0.98
Z1177:Vil1 UTSW 1 74415132 missense probably damaging 1.00
Z1177:Vil1 UTSW 1 74421430 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGGTACCATAGATCACAGCG -3'
(R):5'- GTGATTGGACTTCTATGCCCTG -3'

Sequencing Primer
(F):5'- AGGATGTTGCCACACCTCAG -3'
(R):5'- TGCTCCCAGGGATATAGGAC -3'
Posted On 2015-04-17