Incidental Mutation 'R3939:Zfp345'
ID308585
Institutional Source Beutler Lab
Gene Symbol Zfp345
Ensembl Gene ENSMUSG00000074731
Gene Namezinc finger protein 345
SynonymsOTTMUSG00000015743
MMRRC Submission 040826-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R3939 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location150470991-150485091 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 150472553 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 355 (H355Y)
Ref Sequence ENSEMBL: ENSMUSP00000105540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109914]
Predicted Effect probably damaging
Transcript: ENSMUST00000109914
AA Change: H355Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105540
Gene: ENSMUSG00000074731
AA Change: H355Y

DomainStartEndE-ValueType
KRAB 4 66 9.5e-20 SMART
ZnF_C2H2 103 125 2e-2 SMART
ZnF_C2H2 131 153 2.9e-6 SMART
ZnF_C2H2 159 181 4.1e-3 SMART
ZnF_C2H2 215 237 2.6e-7 SMART
ZnF_C2H2 243 265 1.6e-5 SMART
ZnF_C2H2 271 293 4e-7 SMART
ZnF_C2H2 299 321 1.1e-5 SMART
ZnF_C2H2 327 349 5.9e-7 SMART
ZnF_C2H2 365 387 4.4e-7 SMART
ZnF_C2H2 393 415 7.3e-6 SMART
ZnF_C2H2 421 443 2.7e-5 SMART
ZnF_C2H2 449 471 1.5e-4 SMART
ZnF_C2H2 477 499 1.3e-5 SMART
ZnF_C2H2 505 527 5.1e-6 SMART
ZnF_C2H2 533 555 9.2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117906
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Cacnb4 C A 2: 52,469,489 R169L probably damaging Het
Col13a1 T C 10: 61,863,082 I491V unknown Het
Corin T C 5: 72,339,879 D531G possibly damaging Het
Cx3cr1 C T 9: 120,051,644 V231I probably benign Het
Dennd4c T G 4: 86,774,280 V9G probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Faf1 T G 4: 109,861,879 L394R probably damaging Het
Fgfr4 G A 13: 55,156,494 D116N probably null Het
Flt3 A G 5: 147,356,243 Y518H possibly damaging Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Gk2 T A 5: 97,455,352 L542F possibly damaging Het
Gm4922 T A 10: 18,784,614 E120V probably damaging Het
Hip1 A T 5: 135,428,764 I285N probably benign Het
Kcnd2 C A 6: 21,217,096 D266E probably damaging Het
Kdr C T 5: 75,972,429 W63* probably null Het
Kit A G 5: 75,609,318 D130G probably benign Het
Megf8 G A 7: 25,359,202 V2208I probably benign Het
Neto2 G A 8: 85,674,118 T16I probably damaging Het
Nktr T A 9: 121,749,069 probably benign Het
Nrxn1 A G 17: 90,208,421 I1207T probably damaging Het
Obox7 G A 7: 14,664,047 G4D probably benign Het
Ogdh G A 11: 6,350,655 W827* probably null Het
Olfr1223 T A 2: 89,144,130 K298* probably null Het
Olfr309 T C 7: 86,306,229 M295V probably benign Het
Olfr726 A G 14: 50,083,716 *322Q probably null Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sbpl T A 17: 23,953,643 I101L probably benign Het
Serpina9 T A 12: 104,008,892 M1L probably benign Het
Stxbp6 A G 12: 44,902,858 probably null Het
Synpo2 A G 3: 123,114,590 V359A probably damaging Het
Ttyh1 T A 7: 4,129,318 L155H probably damaging Het
Vil1 A G 1: 74,432,415 D785G probably benign Het
Other mutations in Zfp345
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Zfp345 APN 2 150472729 missense probably damaging 1.00
IGL00846:Zfp345 APN 2 150472618 missense possibly damaging 0.76
IGL01020:Zfp345 APN 2 150473047 missense possibly damaging 0.68
IGL01931:Zfp345 APN 2 150473350 missense probably benign 0.38
IGL02237:Zfp345 APN 2 150474885 splice site probably benign
IGL02335:Zfp345 APN 2 150474543 missense possibly damaging 0.92
IGL02592:Zfp345 APN 2 150473309 missense probably benign 0.36
IGL02736:Zfp345 APN 2 150474554 missense probably damaging 0.99
R0095:Zfp345 UTSW 2 150472300 missense probably damaging 1.00
R0096:Zfp345 UTSW 2 150472300 missense probably damaging 1.00
R0143:Zfp345 UTSW 2 150472555 missense probably benign
R0371:Zfp345 UTSW 2 150472063 missense possibly damaging 0.81
R0412:Zfp345 UTSW 2 150473403 missense probably benign 0.00
R0415:Zfp345 UTSW 2 150474559 splice site probably benign
R0420:Zfp345 UTSW 2 150473243 missense possibly damaging 0.74
R0697:Zfp345 UTSW 2 150472909 missense probably benign 0.13
R0799:Zfp345 UTSW 2 150472351 missense probably benign 0.27
R1881:Zfp345 UTSW 2 150472355 missense probably damaging 1.00
R1954:Zfp345 UTSW 2 150474821 missense probably damaging 1.00
R2004:Zfp345 UTSW 2 150472118 missense possibly damaging 0.90
R2152:Zfp345 UTSW 2 150472658 missense probably benign 0.00
R2153:Zfp345 UTSW 2 150472658 missense probably benign 0.00
R3051:Zfp345 UTSW 2 150474852 missense probably benign 0.07
R3880:Zfp345 UTSW 2 150472155 missense possibly damaging 0.91
R4801:Zfp345 UTSW 2 150473308 missense possibly damaging 0.91
R4802:Zfp345 UTSW 2 150473308 missense possibly damaging 0.91
R4897:Zfp345 UTSW 2 150472688 missense probably benign 0.05
R5606:Zfp345 UTSW 2 150474868 nonsense probably null
R6009:Zfp345 UTSW 2 150472517 missense probably damaging 1.00
R6191:Zfp345 UTSW 2 150473090 missense probably benign 0.11
R6194:Zfp345 UTSW 2 150472631 missense probably damaging 1.00
R6782:Zfp345 UTSW 2 150473354 missense probably damaging 0.97
R6932:Zfp345 UTSW 2 150473411 missense probably damaging 0.99
R7356:Zfp345 UTSW 2 150472289 missense probably damaging 1.00
R7980:Zfp345 UTSW 2 150472803 nonsense probably null
R8387:Zfp345 UTSW 2 150472820 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATTCGTTGCATTCATATGGTCTCTC -3'
(R):5'- GTCCCAGTTCTCTTCAATACCA -3'

Sequencing Primer
(F):5'- GTTCGTTTATGATACAGGAGTCCAC -3'
(R):5'- CCCAGTTCTCTTCAATACCATAAAAG -3'
Posted On2015-04-17