Mutagenetix > Incidental Mutation

Incidental Mutation 'R3939:Kit'

308591

Institutional Source

Beutler Lab

Gene Symbol

Kit

Ensembl Gene

ENSMUSG00000005672

Gene Name

KIT proto-oncogene receptor tyrosine kinase

Synonyms

SCO5, Dominant white spotting, Tr-kit, belly-spot, CD117, Gsfsow3, Gsfsco5, SOW3, SCO1, Steel Factor Receptor, c-KIT, Gsfsco1

MMRRC Submission

040826-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.943) question?

Stock #

R3939 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75574916-75656722 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75609318 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 130 (D130G)

Ref Sequence

ENSEMBL: ENSMUSP00000116465 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005815] [ENSMUST00000144270]

AlphaFold

P05532

Predicted Effect

probably benign
Transcript: ENSMUST00000005815
AA Change: D130G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000005815
Gene: ENSMUSG00000005672
AA Change: D130G

Domain	Start	End	E-Value	Type
low complexity region	10	18	N/A	INTRINSIC
low complexity region	25	38	N/A	INTRINSIC
IG	43	113	3.02e0	SMART
IG_like	122	206	1.09e2	SMART
IGc2	225	300	3.79e-4	SMART
IG	323	413	1.21e-2	SMART
IG_like	429	501	1.88e0	SMART
transmembrane domain	524	546	N/A	INTRINSIC
TyrKc	592	926	2.5e-138	SMART
low complexity region	945	963	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143221

Predicted Effect

probably benign
Transcript: ENSMUST00000144270
AA Change: D130G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000116465
Gene: ENSMUSG00000005672
AA Change: D130G

Domain	Start	End	E-Value	Type
low complexity region	1	10	N/A	INTRINSIC
low complexity region	22	30	N/A	INTRINSIC
low complexity region	37	50	N/A	INTRINSIC
IG	55	125	3.02e0	SMART
IG_like	134	218	1.09e2	SMART
IGc2	237	312	3.79e-4	SMART
IG	335	425	1.21e-2	SMART
IG_like	441	513	1.88e0	SMART
transmembrane domain	532	554	N/A	INTRINSIC
TyrKc	600	934	2.5e-138	SMART
low complexity region	953	971	N/A	INTRINSIC

Meta Mutation Damage Score

0.1013

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

97% (37/38)

MGI Phenotype

FUNCTION: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect migration of embryonic stem cell populations, resulting in mild to severe impairments in hematopoiesis, and pigmentation. Some alleles are homozygous lethal, sterile, or result in the formation of gastrointestinal tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	C	T	X: 70,394,529	A53T	probably benign	Het
Atp13a2	T	C	4: 141,006,422	S1041P	probably damaging	Het
Brinp3	C	A	1: 146,751,861	D277E	probably damaging	Het
Cacnb4	C	A	2: 52,469,489	R169L	probably damaging	Het
Col13a1	T	C	10: 61,863,082	I491V	unknown	Het
Corin	T	C	5: 72,339,879	D531G	possibly damaging	Het
Cx3cr1	C	T	9: 120,051,644	V231I	probably benign	Het
Dennd4c	T	G	4: 86,774,280	V9G	probably damaging	Het
Dysf	G	A	6: 84,186,509		probably null	Het
Faf1	T	G	4: 109,861,879	L394R	probably damaging	Het
Fgfr4	G	A	13: 55,156,494	D116N	probably null	Het
Flt3	A	G	5: 147,356,243	Y518H	possibly damaging	Het
Frem3	T	C	8: 80,615,020	I1314T	possibly damaging	Het
Gk2	T	A	5: 97,455,352	L542F	possibly damaging	Het
Gm4922	T	A	10: 18,784,614	E120V	probably damaging	Het
Hip1	A	T	5: 135,428,764	I285N	probably benign	Het
Kcnd2	C	A	6: 21,217,096	D266E	probably damaging	Het
Kdr	C	T	5: 75,972,429	W63*	probably null	Het
Megf8	G	A	7: 25,359,202	V2208I	probably benign	Het
Neto2	G	A	8: 85,674,118	T16I	probably damaging	Het
Nktr	T	A	9: 121,749,069		probably benign	Het
Nrxn1	A	G	17: 90,208,421	I1207T	probably damaging	Het
Obox7	G	A	7: 14,664,047	G4D	probably benign	Het
Ogdh	G	A	11: 6,350,655	W827*	probably null	Het
Olfr1223	T	A	2: 89,144,130	K298*	probably null	Het
Olfr309	T	C	7: 86,306,229	M295V	probably benign	Het
Olfr726	A	G	14: 50,083,716	*322Q	probably null	Het
Pcdhga9	G	A	18: 37,738,942	R608H	probably benign	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Sbpl	T	A	17: 23,953,643	I101L	probably benign	Het
Serpina9	T	A	12: 104,008,892	M1L	probably benign	Het
Stxbp6	A	G	12: 44,902,858		probably null	Het
Synpo2	A	G	3: 123,114,590	V359A	probably damaging	Het
Ttyh1	T	A	7: 4,129,318	L155H	probably damaging	Het
Vil1	A	G	1: 74,432,415	D785G	probably benign	Het
Zfp345	G	A	2: 150,472,553	H355Y	probably damaging	Het

Other mutations in Kit

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Kit	APN	5	75610819	missense	probably benign	0.00
IGL00834:Kit	APN	5	75645959	missense	probably damaging	1.00
IGL00846:Kit	APN	5	75640811	missense	probably damaging	0.98
IGL01149:Kit	APN	5	75610876	missense	probably damaging	0.97
IGL01341:Kit	APN	5	75607074	missense	probably damaging	1.00
IGL02004:Kit	APN	5	75621014	missense	probably benign
IGL02281:Kit	APN	5	75654534	missense	possibly damaging	0.66
IGL02424:Kit	APN	5	75639106	missense	probably benign
IGL02697:Kit	APN	5	75607259	missense	probably benign
IGL02929:Kit	APN	5	75640769	missense	probably damaging	1.00
IGL03053:Kit	APN	5	75610914	missense	probably benign
IGL03127:Kit	APN	5	75641188	missense	probably benign	0.44
IGL03174:Kit	APN	5	75607113	missense	probably benign
IGL03381:Kit	APN	5	75607128	missense	probably benign	0.04
casper	UTSW	5	75645875	missense	probably damaging	1.00
Mooyah2	UTSW	5	75652808	missense	probably damaging	1.00
pretty2	UTSW	5	75649550	missense	probably damaging	1.00
slimmer	UTSW	5	75640757	missense	possibly damaging	0.94
IGL02837:Kit	UTSW	5	75639008	missense	probably benign	0.00
R0022:Kit	UTSW	5	75622997	missense	probably benign	0.00
R0022:Kit	UTSW	5	75622997	missense	probably benign	0.00
R0092:Kit	UTSW	5	75647754	missense	possibly damaging	0.93
R0254:Kit	UTSW	5	75620921	missense	probably benign
R0329:Kit	UTSW	5	75652829	missense	probably damaging	1.00
R0609:Kit	UTSW	5	75610879	missense	probably benign	0.35
R1068:Kit	UTSW	5	75609518	missense	probably benign
R1115:Kit	UTSW	5	75649532	splice site	probably benign
R1480:Kit	UTSW	5	75637317	missense	probably benign	0.00
R1639:Kit	UTSW	5	75652807	missense	probably damaging	1.00
R1801:Kit	UTSW	5	75648393	missense	probably damaging	1.00
R1973:Kit	UTSW	5	75615442	missense	probably damaging	1.00
R2033:Kit	UTSW	5	75637317	missense	possibly damaging	0.88
R3125:Kit	UTSW	5	75647827	missense	probably benign	0.07
R3125:Kit	UTSW	5	75647828	missense	probably null	0.00
R3437:Kit	UTSW	5	75645905	missense	probably damaging	1.00
R3791:Kit	UTSW	5	75639150	missense	probably damaging	1.00
R3940:Kit	UTSW	5	75609318	missense	probably benign	0.00
R3941:Kit	UTSW	5	75609318	missense	probably benign	0.00
R3942:Kit	UTSW	5	75609318	missense	probably benign	0.00
R4092:Kit	UTSW	5	75610810	missense	probably benign	0.28
R4376:Kit	UTSW	5	75640499	missense	probably benign	0.00
R4377:Kit	UTSW	5	75640499	missense	probably benign	0.00
R4668:Kit	UTSW	5	75641220	splice site	probably null
R5104:Kit	UTSW	5	75615478	missense	probably benign	0.00
R5152:Kit	UTSW	5	75620847	missense	probably benign	0.00
R5154:Kit	UTSW	5	75640540	missense	probably damaging	0.99
R5508:Kit	UTSW	5	75649548	missense	probably damaging	1.00
R5624:Kit	UTSW	5	75609394	missense	probably benign	0.40
R5731:Kit	UTSW	5	75654415	missense	possibly damaging	0.93
R6270:Kit	UTSW	5	75609509	missense	probably benign
R6565:Kit	UTSW	5	75645853	missense	probably damaging	1.00
R6694:Kit	UTSW	5	75640757	missense	possibly damaging	0.94
R6805:Kit	UTSW	5	75652808	missense	probably damaging	1.00
R6823:Kit	UTSW	5	75652649	missense	probably benign	0.01
R6848:Kit	UTSW	5	75607212	missense	probably benign
R7021:Kit	UTSW	5	75620967	missense	probably benign	0.00
R7080:Kit	UTSW	5	75607281	missense	probably damaging	0.99
R7117:Kit	UTSW	5	75607098	missense	probably benign	0.18
R7156:Kit	UTSW	5	75615374	missense	probably benign	0.14
R7379:Kit	UTSW	5	75647752	missense	probably damaging	1.00
R7427:Kit	UTSW	5	75645847	missense	possibly damaging	0.92
R7438:Kit	UTSW	5	75639000	missense	probably benign	0.01
R7531:Kit	UTSW	5	75607040	missense	probably damaging	0.99
R7711:Kit	UTSW	5	75637359	missense	probably damaging	0.97
R7810:Kit	UTSW	5	75609322	missense	probably benign	0.11
R7819:Kit	UTSW	5	75645932	missense	probably benign	0.41
R8021:Kit	UTSW	5	75615491	missense	possibly damaging	0.79
R8139:Kit	UTSW	5	75652805	missense	probably damaging	0.99
R8165:Kit	UTSW	5	75620880	missense	possibly damaging	0.94
R8249:Kit	UTSW	5	75641408	missense	probably damaging	0.97
R8288:Kit	UTSW	5	75654489	missense	probably damaging	1.00
R8290:Kit	UTSW	5	75641169	missense	probably benign
R8829:Kit	UTSW	5	75639131	missense	probably benign	0.41
R8832:Kit	UTSW	5	75639131	missense	probably benign	0.41
R8969:Kit	UTSW	5	75639062	missense
R9081:Kit	UTSW	5	75640558	missense	probably benign
R9146:Kit	UTSW	5	75649645	missense	probably damaging	1.00
R9232:Kit	UTSW	5	75639132	missense	probably benign	0.00
R9631:Kit	UTSW	5	75607029	missense	possibly damaging	0.95
U24488:Kit	UTSW	5	75623014	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGAAATCCATTGTGTTATTCAAGCTT -3'
(R):5'- GGACACAGAGCCGGTGGT -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCTGAGGCG -3'
(R):5'- TGGTAGGCGCGCTTCAC -3'

Posted On

2015-04-17