Mutagenetix > Incidental Mutation

Incidental Mutation 'R3939:Kcnd2'

308597

Institutional Source

Beutler Lab

Gene Symbol

Kcnd2

Ensembl Gene

ENSMUSG00000060882

Gene Name

potassium voltage-gated channel, Shal-related family, member 2

Synonyms

Kv4.2

MMRRC Submission

040826-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.163) question?

Stock #

R3939 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21215503-21729805 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 21217096 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 266 (D266E)

Ref Sequence

ENSEMBL: ENSMUSP00000080257 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081542]

AlphaFold

Q9Z0V2

Predicted Effect

probably damaging
Transcript: ENSMUST00000081542
AA Change: D266E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080257
Gene: ENSMUSG00000060882
AA Change: D266E

Domain	Start	End	E-Value	Type
Pfam:Shal-type	3	31	4.5e-16	PFAM
BTB	41	140	3.42e-14	SMART
Pfam:Ion_trans	184	417	1.4e-44	PFAM
Pfam:Ion_trans_2	330	411	5.5e-15	PFAM
low complexity region	418	437	N/A	INTRINSIC
Pfam:DUF3399	445	546	5.5e-44	PFAM
low complexity region	594	608	N/A	INTRINSIC

Meta Mutation Damage Score

0.9538

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

97% (37/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member mediates a rapidly inactivating, A-type outward potassium current which is not under the control of the N terminus as it is in Shaker channels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene reduces A-type currents in spinal cord dorsal horn neurons and increases their excitability, resulting in enhanced sensitivity to tactile and thermal stimuli. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	C	T	X: 70,394,529	A53T	probably benign	Het
Atp13a2	T	C	4: 141,006,422	S1041P	probably damaging	Het
Brinp3	C	A	1: 146,751,861	D277E	probably damaging	Het
Cacnb4	C	A	2: 52,469,489	R169L	probably damaging	Het
Col13a1	T	C	10: 61,863,082	I491V	unknown	Het
Corin	T	C	5: 72,339,879	D531G	possibly damaging	Het
Cx3cr1	C	T	9: 120,051,644	V231I	probably benign	Het
Dennd4c	T	G	4: 86,774,280	V9G	probably damaging	Het
Dysf	G	A	6: 84,186,509		probably null	Het
Faf1	T	G	4: 109,861,879	L394R	probably damaging	Het
Fgfr4	G	A	13: 55,156,494	D116N	probably null	Het
Flt3	A	G	5: 147,356,243	Y518H	possibly damaging	Het
Frem3	T	C	8: 80,615,020	I1314T	possibly damaging	Het
Gk2	T	A	5: 97,455,352	L542F	possibly damaging	Het
Gm4922	T	A	10: 18,784,614	E120V	probably damaging	Het
Hip1	A	T	5: 135,428,764	I285N	probably benign	Het
Kdr	C	T	5: 75,972,429	W63*	probably null	Het
Kit	A	G	5: 75,609,318	D130G	probably benign	Het
Megf8	G	A	7: 25,359,202	V2208I	probably benign	Het
Neto2	G	A	8: 85,674,118	T16I	probably damaging	Het
Nktr	T	A	9: 121,749,069		probably benign	Het
Nrxn1	A	G	17: 90,208,421	I1207T	probably damaging	Het
Obox7	G	A	7: 14,664,047	G4D	probably benign	Het
Ogdh	G	A	11: 6,350,655	W827*	probably null	Het
Olfr1223	T	A	2: 89,144,130	K298*	probably null	Het
Olfr309	T	C	7: 86,306,229	M295V	probably benign	Het
Olfr726	A	G	14: 50,083,716	*322Q	probably null	Het
Pcdhga9	G	A	18: 37,738,942	R608H	probably benign	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Sbpl	T	A	17: 23,953,643	I101L	probably benign	Het
Serpina9	T	A	12: 104,008,892	M1L	probably benign	Het
Stxbp6	A	G	12: 44,902,858		probably null	Het
Synpo2	A	G	3: 123,114,590	V359A	probably damaging	Het
Ttyh1	T	A	7: 4,129,318	L155H	probably damaging	Het
Vil1	A	G	1: 74,432,415	D785G	probably benign	Het
Zfp345	G	A	2: 150,472,553	H355Y	probably damaging	Het

Other mutations in Kcnd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00983:Kcnd2	APN	6	21714154	missense	possibly damaging	0.90
IGL01124:Kcnd2	APN	6	21217217	missense	probably damaging	1.00
IGL01317:Kcnd2	APN	6	21727340	makesense	probably null
IGL01534:Kcnd2	APN	6	21726145	missense	probably benign
IGL02623:Kcnd2	APN	6	21726195	missense	probably benign	0.05
IGL02682:Kcnd2	APN	6	21216925	nonsense	probably null
IGL02874:Kcnd2	APN	6	21216923	missense	probably damaging	1.00
IGL02982:Kcnd2	APN	6	21217149	missense	probably damaging	1.00
IGL02983:Kcnd2	APN	6	21216555	missense	probably damaging	1.00
IGL03119:Kcnd2	APN	6	21216509	nonsense	probably null
IGL03154:Kcnd2	APN	6	21216708	missense	probably damaging	1.00
IGL03174:Kcnd2	APN	6	21216516	missense	possibly damaging	0.93
IGL03296:Kcnd2	APN	6	21714209	missense	probably damaging	1.00
R0062:Kcnd2	UTSW	6	21727226	missense	possibly damaging	0.80
R0062:Kcnd2	UTSW	6	21727226	missense	possibly damaging	0.80
R0325:Kcnd2	UTSW	6	21216683	missense	probably damaging	0.99
R0771:Kcnd2	UTSW	6	21216442	missense	probably damaging	1.00
R0836:Kcnd2	UTSW	6	21726239	splice site	probably benign
R0836:Kcnd2	UTSW	6	21727329	missense	probably damaging	1.00
R0884:Kcnd2	UTSW	6	21216541	missense	probably benign
R1434:Kcnd2	UTSW	6	21216357	missense	probably damaging	1.00
R2116:Kcnd2	UTSW	6	21216432	missense	probably damaging	1.00
R3863:Kcnd2	UTSW	6	21217263	nonsense	probably null
R4427:Kcnd2	UTSW	6	21216897	missense	probably damaging	0.99
R4561:Kcnd2	UTSW	6	21216396	missense	probably benign
R4707:Kcnd2	UTSW	6	21723212	missense	probably benign
R5523:Kcnd2	UTSW	6	21723212	missense	probably benign
R5545:Kcnd2	UTSW	6	21217019	missense	probably damaging	1.00
R5926:Kcnd2	UTSW	6	21217085	missense	probably damaging	0.99
R6900:Kcnd2	UTSW	6	21216588	missense	probably damaging	1.00
R7010:Kcnd2	UTSW	6	21216708	missense	probably damaging	1.00
R7028:Kcnd2	UTSW	6	21216178	start gained	probably benign
R7183:Kcnd2	UTSW	6	21216437	missense	probably damaging	1.00
R7387:Kcnd2	UTSW	6	21216778	missense	probably benign	0.28
R7463:Kcnd2	UTSW	6	21216498	missense	probably damaging	1.00
R8007:Kcnd2	UTSW	6	21217074	missense	probably damaging	0.99
R8305:Kcnd2	UTSW	6	21726198	nonsense	probably null
R8465:Kcnd2	UTSW	6	21216696	missense	probably damaging	1.00
R9329:Kcnd2	UTSW	6	21725982	missense	probably damaging	1.00
R9532:Kcnd2	UTSW	6	21727181	missense	probably benign	0.16
R9766:Kcnd2	UTSW	6	21216368	missense	probably benign	0.20
X0021:Kcnd2	UTSW	6	21217323	missense	probably damaging	0.99
Z1177:Kcnd2	UTSW	6	21216416	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACTGGGTTCTTCATTGCCGTC -3'
(R):5'- CCAGTTCTGATGCACAGCTC -3'

Sequencing Primer
(F):5'- AAACAGTTCCATGTGGGTCTAGCC -3'
(R):5'- ATGCACAGCTCTTCAGGGTGTAC -3'

Posted On

2015-04-17