Incidental Mutation 'R3939:Ogdh'
ID308611
Institutional Source Beutler Lab
Gene Symbol Ogdh
Ensembl Gene ENSMUSG00000020456
Gene Nameoxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
Synonyms2210403E04Rik, alpha-ketoglutarate dehydrogenase, d1401, 2210412K19Rik
MMRRC Submission 040826-MU
Accession Numbers

Genbank: NM_010956; MGI: 1098267; Ensembl: ENSMUST00000093350

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3939 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location6291633-6356642 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 6350655 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 827 (W827*)
Ref Sequence ENSEMBL: ENSMUSP00000099090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003461] [ENSMUST00000081894] [ENSMUST00000093350] [ENSMUST00000101554]
Predicted Effect probably null
Transcript: ENSMUST00000003461
AA Change: W827*
SMART Domains Protein: ENSMUSP00000003461
Gene: ENSMUSG00000020456
AA Change: W827*

DomainStartEndE-ValueType
Blast:Transket_pyr 131 199 8e-13 BLAST
Pfam:E1_dh 256 582 1.4e-95 PFAM
Transket_pyr 651 865 3.44e-50 SMART
Predicted Effect probably null
Transcript: ENSMUST00000081894
AA Change: W823*
SMART Domains Protein: ENSMUSP00000080569
Gene: ENSMUSG00000020456
AA Change: W823*

DomainStartEndE-ValueType
Pfam:E1_dh 252 578 1e-96 PFAM
Transket_pyr 647 861 3.44e-50 SMART
Predicted Effect probably null
Transcript: ENSMUST00000093350
AA Change: W838*
SMART Domains Protein: ENSMUSP00000091041
Gene: ENSMUSG00000020456
AA Change: W838*

DomainStartEndE-ValueType
Pfam:2-oxogl_dehyd_N 47 87 6.6e-21 PFAM
Pfam:E1_dh 267 593 1.1e-101 PFAM
Transket_pyr 662 876 3.44e-50 SMART
Pfam:OxoGdeHyase_C 880 1025 8.7e-58 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000101554
AA Change: W827*
SMART Domains Protein: ENSMUSP00000099090
Gene: ENSMUSG00000020456
AA Change: W827*

DomainStartEndE-ValueType
Blast:Transket_pyr 131 199 8e-13 BLAST
Pfam:E1_dh 256 582 1.4e-95 PFAM
Transket_pyr 651 865 3.44e-50 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one subunit of the 2-oxoglutarate dehydrogenase complex. This complex catalyzes the overall conversion of 2-oxoglutarate (alpha-ketoglutarate) to succinyl-CoA and CO(2) during the Krebs cycle. The protein is located in the mitochondrial matrix and uses thiamine pyrophosphate as a cofactor. A congenital deficiency in 2-oxoglutarate dehydrogenase activity is believed to lead to hypotonia, metabolic acidosis, and hyperlactatemia. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Sep 2009]
Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Cacnb4 C A 2: 52,469,489 R169L probably damaging Het
Col13a1 T C 10: 61,863,082 I491V unknown Het
Corin T C 5: 72,339,879 D531G possibly damaging Het
Cx3cr1 C T 9: 120,051,644 V231I probably benign Het
Dennd4c T G 4: 86,774,280 V9G probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Faf1 T G 4: 109,861,879 L394R probably damaging Het
Fgfr4 G A 13: 55,156,494 D116N probably null Het
Flt3 A G 5: 147,356,243 Y518H possibly damaging Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Gk2 T A 5: 97,455,352 L542F possibly damaging Het
Gm4922 T A 10: 18,784,614 E120V probably damaging Het
Hip1 A T 5: 135,428,764 I285N probably benign Het
Kcnd2 C A 6: 21,217,096 D266E probably damaging Het
Kdr C T 5: 75,972,429 W63* probably null Het
Kit A G 5: 75,609,318 D130G probably benign Het
Megf8 G A 7: 25,359,202 V2208I probably benign Het
Neto2 G A 8: 85,674,118 T16I probably damaging Het
Nktr T A 9: 121,749,069 probably benign Het
Nrxn1 A G 17: 90,208,421 I1207T probably damaging Het
Obox7 G A 7: 14,664,047 G4D probably benign Het
Olfr1223 T A 2: 89,144,130 K298* probably null Het
Olfr309 T C 7: 86,306,229 M295V probably benign Het
Olfr726 A G 14: 50,083,716 *322Q probably null Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sbpl T A 17: 23,953,643 I101L probably benign Het
Serpina9 T A 12: 104,008,892 M1L probably benign Het
Stxbp6 A G 12: 44,902,858 probably null Het
Synpo2 A G 3: 123,114,590 V359A probably damaging Het
Ttyh1 T A 7: 4,129,318 L155H probably damaging Het
Vil1 A G 1: 74,432,415 D785G probably benign Het
Zfp345 G A 2: 150,472,553 H355Y probably damaging Het
Other mutations in Ogdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Ogdh APN 11 6348790 missense probably damaging 1.00
IGL01503:Ogdh APN 11 6355069 missense probably damaging 1.00
IGL01684:Ogdh APN 11 6342546 missense probably damaging 1.00
IGL02141:Ogdh APN 11 6355015 missense probably damaging 1.00
IGL02313:Ogdh APN 11 6355400 missense probably damaging 0.98
IGL02818:Ogdh APN 11 6348270 missense probably benign
N/A - 535:Ogdh UTSW 11 6324911 missense possibly damaging 0.60
PIT4498001:Ogdh UTSW 11 6340504 missense probably benign 0.09
R0328:Ogdh UTSW 11 6347216 missense probably benign 0.01
R0505:Ogdh UTSW 11 6339936 splice site probably benign
R0627:Ogdh UTSW 11 6347216 missense possibly damaging 0.78
R1119:Ogdh UTSW 11 6340544 missense probably damaging 1.00
R1480:Ogdh UTSW 11 6347827 critical splice acceptor site probably null
R1591:Ogdh UTSW 11 6349384 missense probably damaging 1.00
R1804:Ogdh UTSW 11 6338565 missense probably damaging 1.00
R1873:Ogdh UTSW 11 6340438 splice site probably benign
R1959:Ogdh UTSW 11 6346638 missense possibly damaging 0.49
R2004:Ogdh UTSW 11 6334626 missense possibly damaging 0.90
R2080:Ogdh UTSW 11 6349393 missense probably benign 0.00
R2384:Ogdh UTSW 11 6342526 missense probably damaging 1.00
R2656:Ogdh UTSW 11 6348678 missense probably benign
R2883:Ogdh UTSW 11 6334545 missense probably damaging 1.00
R3405:Ogdh UTSW 11 6349462 missense probably damaging 1.00
R3838:Ogdh UTSW 11 6338627 nonsense probably null
R3933:Ogdh UTSW 11 6342601 missense possibly damaging 0.72
R4296:Ogdh UTSW 11 6349374 missense probably damaging 0.97
R4393:Ogdh UTSW 11 6316772 missense probably damaging 1.00
R4427:Ogdh UTSW 11 6355421 missense probably benign 0.01
R4667:Ogdh UTSW 11 6340600 missense probably benign 0.20
R4669:Ogdh UTSW 11 6340600 missense probably benign 0.20
R4728:Ogdh UTSW 11 6342549 missense probably damaging 1.00
R4737:Ogdh UTSW 11 6297044 missense probably benign
R4785:Ogdh UTSW 11 6349875 missense probably damaging 1.00
R4796:Ogdh UTSW 11 6340570 missense probably benign 0.01
R5333:Ogdh UTSW 11 6352126 missense probably damaging 1.00
R5592:Ogdh UTSW 11 6316763 splice site probably null
R6318:Ogdh UTSW 11 6349390 missense probably damaging 0.99
R6875:Ogdh UTSW 11 6340477 missense probably benign 0.12
R6988:Ogdh UTSW 11 6313806 nonsense probably null
R7406:Ogdh UTSW 11 6348351 missense probably benign 0.00
R7724:Ogdh UTSW 11 6324887 missense probably benign
R7763:Ogdh UTSW 11 6338558 missense probably benign
R7909:Ogdh UTSW 11 6313965 missense possibly damaging 0.55
R8207:Ogdh UTSW 11 6349329 missense probably benign 0.38
R8348:Ogdh UTSW 11 6342619 missense probably damaging 0.98
Z1088:Ogdh UTSW 11 6355427 missense probably benign
Z1177:Ogdh UTSW 11 6297051 missense probably benign
Z1177:Ogdh UTSW 11 6316982 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CCTCAGTGAGTCCTTGAGTGTC -3'
(R):5'- AACTGACTTCTGAGACCACG -3'

Sequencing Primer
(F):5'- CTTGAGTGTCCTGAGAGACATCC -3'
(R):5'- CCTTTAGGTATCACTCAACCAATC -3'
Posted On2015-04-17