Incidental Mutation 'R3929:Trmo'
ID308625
Institutional Source Beutler Lab
Gene Symbol Trmo
Ensembl Gene ENSMUSG00000028331
Gene NametRNA methyltransferase O
Synonyms5830415F09Rik
MMRRC Submission 040824-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3929 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location46376505-46389437 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46382647 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 150 (G150S)
Ref Sequence ENSEMBL: ENSMUSP00000083752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030015] [ENSMUST00000086563] [ENSMUST00000151903]
Predicted Effect probably damaging
Transcript: ENSMUST00000030015
AA Change: G150S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030015
Gene: ENSMUSG00000028331
AA Change: G150S

DomainStartEndE-ValueType
Pfam:UPF0066 42 165 2.3e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086563
AA Change: G150S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083752
Gene: ENSMUSG00000028331
AA Change: G150S

DomainStartEndE-ValueType
Pfam:UPF0066 44 164 1.2e-46 PFAM
low complexity region 431 442 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151903
AA Change: G157S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119785
Gene: ENSMUSG00000028331
AA Change: G157S

DomainStartEndE-ValueType
Pfam:UPF0066 49 172 4.1e-45 PFAM
Meta Mutation Damage Score 0.5877 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 A C 3: 152,667,807 L18R probably damaging Het
Atrx T C X: 105,879,917 I157V possibly damaging Het
C9 T A 15: 6,467,458 I212N probably benign Het
Cabin1 T C 10: 75,751,618 probably null Het
Ccnf A G 17: 24,234,382 V361A probably damaging Het
Ctps T A 4: 120,541,896 H553L probably benign Het
Dmrta1 C T 4: 89,691,444 Q214* probably null Het
E230025N22Rik T C 18: 36,691,572 D112G probably damaging Het
Frat1 T C 19: 41,830,648 C161R probably damaging Het
H1foo A G 6: 115,948,796 K185E probably benign Het
Itpr2 C A 6: 146,374,359 probably null Het
Klhl40 A G 9: 121,780,676 D509G probably benign Het
Muc5ac T C 7: 141,802,892 V1072A probably benign Het
Nav3 A G 10: 109,684,203 Y2340H probably damaging Het
Olfr1105 T A 2: 87,034,084 I46F possibly damaging Het
Olfr1331 T C 4: 118,868,982 L66P probably damaging Het
Olfr1390 A T 11: 49,340,993 M154L probably benign Het
Olfr644 C T 7: 104,068,584 C149Y probably benign Het
Olfr791 G A 10: 129,526,231 M1I probably null Het
Prdm10 T C 9: 31,347,136 I619T probably damaging Het
Rp1 T C 1: 4,352,645 T71A probably damaging Het
Rpusd4 A G 9: 35,272,580 I202V probably benign Het
Sin3a A G 9: 57,118,137 N1089S probably damaging Het
St6gal2 A G 17: 55,496,323 D353G possibly damaging Het
Stap2 A C 17: 56,003,156 F50V probably damaging Het
Stkld1 T A 2: 26,940,047 probably null Het
Tarsl2 A G 7: 65,684,043 probably null Het
Tbl1xr1 G C 3: 22,189,768 D69H probably damaging Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trim61 A G 8: 65,013,317 F431L probably benign Het
Vmn1r61 A G 7: 5,611,177 I46T probably benign Het
Vmn2r19 T C 6: 123,315,628 Y210H probably benign Het
Xrn1 T C 9: 95,988,873 S584P possibly damaging Het
Other mutations in Trmo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Trmo APN 4 46382490 missense probably benign
IGL01296:Trmo APN 4 46387589 missense probably damaging 1.00
IGL01308:Trmo APN 4 46377053 utr 3 prime probably benign
IGL01544:Trmo APN 4 46386169 missense probably damaging 1.00
IGL01545:Trmo APN 4 46386169 missense probably damaging 1.00
IGL01722:Trmo APN 4 46386092 critical splice donor site probably null
IGL02085:Trmo APN 4 46380217 missense probably damaging 1.00
IGL02927:Trmo APN 4 46387602 missense probably damaging 1.00
R0645:Trmo UTSW 4 46377083 utr 3 prime probably benign
R0745:Trmo UTSW 4 46382104 missense probably damaging 1.00
R1365:Trmo UTSW 4 46380278 missense probably damaging 1.00
R1835:Trmo UTSW 4 46380158 missense probably damaging 1.00
R3928:Trmo UTSW 4 46382647 missense probably damaging 1.00
R4497:Trmo UTSW 4 46382140 missense probably damaging 1.00
R4938:Trmo UTSW 4 46382388 missense probably benign 0.00
R4980:Trmo UTSW 4 46389364 nonsense probably null
R5209:Trmo UTSW 4 46387740 missense probably damaging 0.99
R5639:Trmo UTSW 4 46382073 missense probably benign 0.00
R5855:Trmo UTSW 4 46382568 missense probably benign 0.43
R6151:Trmo UTSW 4 46389390 missense probably damaging 1.00
R7351:Trmo UTSW 4 46387716 missense possibly damaging 0.78
R8684:Trmo UTSW 4 46386251 nonsense probably null
R8684:Trmo UTSW 4 46386253 critical splice acceptor site probably null
R8823:Trmo UTSW 4 46382604 missense probably damaging 1.00
R8856:Trmo UTSW 4 46387625 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGGCGAGGCTGTACTTTC -3'
(R):5'- AATGACGTGTTCTATGAGAGCCTTG -3'

Sequencing Primer
(F):5'- GAGGCTGTACTTTCCCACG -3'
(R):5'- ACGTGTTCTATGAGAGCCTTGAAGAG -3'
Posted On2015-04-17