Incidental Mutation 'R3929:Ctps'
ID308628
Institutional Source Beutler Lab
Gene Symbol Ctps
Ensembl Gene ENSMUSG00000028633
Gene Namecytidine 5'-triphosphate synthase
Synonyms
MMRRC Submission 040824-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R3929 (G1)
Quality Score218
Status Not validated
Chromosome4
Chromosomal Location120539868-120570276 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120541896 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 553 (H553L)
Ref Sequence ENSEMBL: ENSMUSP00000030381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030381]
Predicted Effect probably benign
Transcript: ENSMUST00000030381
AA Change: H553L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030381
Gene: ENSMUSG00000028633
AA Change: H553L

DomainStartEndE-ValueType
Pfam:CTP_synth_N 2 277 2.8e-135 PFAM
Pfam:GATase 309 546 6.7e-55 PFAM
Pfam:Peptidase_C26 378 528 3.8e-10 PFAM
low complexity region 565 578 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147980
Meta Mutation Damage Score 0.0836 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme responsible for the catalytic conversion of UTP (uridine triphosphate) to CTP (cytidine triphospate). This reaction is an important step in the biosynthesis of phospholipids and nucleic acids. Activity of this proten is important in the immune system, and loss of function of this gene has been associated with immunodeficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 A C 3: 152,667,807 L18R probably damaging Het
Atrx T C X: 105,879,917 I157V possibly damaging Het
C9 T A 15: 6,467,458 I212N probably benign Het
Cabin1 T C 10: 75,751,618 probably null Het
Ccnf A G 17: 24,234,382 V361A probably damaging Het
Dmrta1 C T 4: 89,691,444 Q214* probably null Het
E230025N22Rik T C 18: 36,691,572 D112G probably damaging Het
Frat1 T C 19: 41,830,648 C161R probably damaging Het
H1foo A G 6: 115,948,796 K185E probably benign Het
Itpr2 C A 6: 146,374,359 probably null Het
Klhl40 A G 9: 121,780,676 D509G probably benign Het
Muc5ac T C 7: 141,802,892 V1072A probably benign Het
Nav3 A G 10: 109,684,203 Y2340H probably damaging Het
Olfr1105 T A 2: 87,034,084 I46F possibly damaging Het
Olfr1331 T C 4: 118,868,982 L66P probably damaging Het
Olfr1390 A T 11: 49,340,993 M154L probably benign Het
Olfr644 C T 7: 104,068,584 C149Y probably benign Het
Olfr791 G A 10: 129,526,231 M1I probably null Het
Prdm10 T C 9: 31,347,136 I619T probably damaging Het
Rp1 T C 1: 4,352,645 T71A probably damaging Het
Rpusd4 A G 9: 35,272,580 I202V probably benign Het
Sin3a A G 9: 57,118,137 N1089S probably damaging Het
St6gal2 A G 17: 55,496,323 D353G possibly damaging Het
Stap2 A C 17: 56,003,156 F50V probably damaging Het
Stkld1 T A 2: 26,940,047 probably null Het
Tarsl2 A G 7: 65,684,043 probably null Het
Tbl1xr1 G C 3: 22,189,768 D69H probably damaging Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trim61 A G 8: 65,013,317 F431L probably benign Het
Trmo C T 4: 46,382,647 G150S probably damaging Het
Vmn1r61 A G 7: 5,611,177 I46T probably benign Het
Vmn2r19 T C 6: 123,315,628 Y210H probably benign Het
Xrn1 T C 9: 95,988,873 S584P possibly damaging Het
Other mutations in Ctps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Ctps APN 4 120552944 missense probably damaging 1.00
IGL00919:Ctps APN 4 120567348 missense probably benign 0.03
IGL01510:Ctps APN 4 120558844 missense probably damaging 0.98
IGL01686:Ctps APN 4 120553986 missense probably benign
IGL01897:Ctps APN 4 120567279 missense probably damaging 1.00
IGL02261:Ctps APN 4 120542579 missense possibly damaging 0.53
IGL02797:Ctps APN 4 120562824 missense probably benign 0.03
R0125:Ctps UTSW 4 120561525 splice site probably benign
R1053:Ctps UTSW 4 120543722 splice site probably null
R2087:Ctps UTSW 4 120562815 missense probably benign 0.12
R3736:Ctps UTSW 4 120543746 missense probably benign
R3928:Ctps UTSW 4 120541896 missense probably benign
R4193:Ctps UTSW 4 120548138 missense probably damaging 1.00
R4389:Ctps UTSW 4 120558790 missense probably damaging 1.00
R4853:Ctps UTSW 4 120554010 missense probably damaging 1.00
R5045:Ctps UTSW 4 120552878 critical splice donor site probably null
R5074:Ctps UTSW 4 120553973 missense probably damaging 1.00
R5566:Ctps UTSW 4 120554103 splice site probably null
R6235:Ctps UTSW 4 120558806 missense probably benign 0.42
R6828:Ctps UTSW 4 120548138 missense probably damaging 1.00
R7232:Ctps UTSW 4 120548124 missense probably damaging 1.00
R7487:Ctps UTSW 4 120558800 missense probably damaging 1.00
X0027:Ctps UTSW 4 120554093 missense probably damaging 1.00
X0062:Ctps UTSW 4 120542617 missense probably benign
Z1176:Ctps UTSW 4 120542743 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCCTGGCCAGCAAGATAG -3'
(R):5'- GTGTAGCAGTGTCAGCTGACTC -3'

Sequencing Primer
(F):5'- GATAGGGGCAGCCTAACAAC -3'
(R):5'- TAGCAGTGTCAGCTGACTCCTTTTC -3'
Posted On2015-04-17