Mutagenetix > Incidental Mutation

Incidental Mutation 'R3929:Vmn2r19'

308631

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r19

Ensembl Gene

ENSMUSG00000091260

Gene Name

vomeronasal 2, receptor 19

Synonyms

EG232358

MMRRC Submission

040824-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R3929 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

123308333-123336537 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 123315628 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 210 (Y210H)

Ref Sequence

ENSEMBL: ENSMUSP00000073604 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073948]

AlphaFold

G5E8G4

Predicted Effect

probably benign
Transcript: ENSMUST00000073948
AA Change: Y210H

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000073604
Gene: ENSMUSG00000091260
AA Change: Y210H

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Pfam:ANF_receptor	81	476	2.9e-35	PFAM
Pfam:NCD3G	518	571	8.3e-23	PFAM
Pfam:7tm_3	603	839	7.2e-52	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ak5	A	C	3: 152,667,807	L18R	probably damaging	Het
Atrx	T	C	X: 105,879,917	I157V	possibly damaging	Het
C9	T	A	15: 6,467,458	I212N	probably benign	Het
Cabin1	T	C	10: 75,751,618		probably null	Het
Ccnf	A	G	17: 24,234,382	V361A	probably damaging	Het
Ctps	T	A	4: 120,541,896	H553L	probably benign	Het
Dmrta1	C	T	4: 89,691,444	Q214*	probably null	Het
E230025N22Rik	T	C	18: 36,691,572	D112G	probably damaging	Het
Frat1	T	C	19: 41,830,648	C161R	probably damaging	Het
H1foo	A	G	6: 115,948,796	K185E	probably benign	Het
Itpr2	C	A	6: 146,374,359		probably null	Het
Klhl40	A	G	9: 121,780,676	D509G	probably benign	Het
Muc5ac	T	C	7: 141,802,892	V1072A	probably benign	Het
Nav3	A	G	10: 109,684,203	Y2340H	probably damaging	Het
Olfr1105	T	A	2: 87,034,084	I46F	possibly damaging	Het
Olfr1331	T	C	4: 118,868,982	L66P	probably damaging	Het
Olfr1390	A	T	11: 49,340,993	M154L	probably benign	Het
Olfr644	C	T	7: 104,068,584	C149Y	probably benign	Het
Olfr791	G	A	10: 129,526,231	M1I	probably null	Het
Prdm10	T	C	9: 31,347,136	I619T	probably damaging	Het
Rp1	T	C	1: 4,352,645	T71A	probably damaging	Het
Rpusd4	A	G	9: 35,272,580	I202V	probably benign	Het
Sin3a	A	G	9: 57,118,137	N1089S	probably damaging	Het
St6gal2	A	G	17: 55,496,323	D353G	possibly damaging	Het
Stap2	A	C	17: 56,003,156	F50V	probably damaging	Het
Stkld1	T	A	2: 26,940,047		probably null	Het
Tarsl2	A	G	7: 65,684,043		probably null	Het
Tbl1xr1	G	C	3: 22,189,768	D69H	probably damaging	Het
Tnrc6c	C	T	11: 117,723,529	R838W	probably damaging	Het
Trim61	A	G	8: 65,013,317	F431L	probably benign	Het
Trmo	C	T	4: 46,382,647	G150S	probably damaging	Het
Vmn1r61	A	G	7: 5,611,177	I46T	probably benign	Het
Xrn1	T	C	9: 95,988,873	S584P	possibly damaging	Het

Other mutations in Vmn2r19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01407:Vmn2r19	APN	6	123329867	missense	possibly damaging	0.92
IGL02294:Vmn2r19	APN	6	123329978	missense	probably benign	0.19
IGL02442:Vmn2r19	APN	6	123309662	missense	possibly damaging	0.94
IGL02871:Vmn2r19	APN	6	123336083	missense	probably damaging	1.00
H8562:Vmn2r19	UTSW	6	123315902	missense	possibly damaging	0.82
R0025:Vmn2r19	UTSW	6	123331547	missense	probably benign	0.01
R0389:Vmn2r19	UTSW	6	123335986	missense	possibly damaging	0.53
R0402:Vmn2r19	UTSW	6	123336182	missense	probably damaging	1.00
R0411:Vmn2r19	UTSW	6	123309744	missense	probably damaging	0.98
R0554:Vmn2r19	UTSW	6	123336143	missense	probably damaging	0.99
R0578:Vmn2r19	UTSW	6	123335972	missense	probably damaging	1.00
R1102:Vmn2r19	UTSW	6	123336173	missense	probably benign	0.28
R1652:Vmn2r19	UTSW	6	123315697	missense	possibly damaging	0.68
R1663:Vmn2r19	UTSW	6	123336452	missense	probably benign	0.11
R1817:Vmn2r19	UTSW	6	123330052	missense	possibly damaging	0.80
R1866:Vmn2r19	UTSW	6	123331638	critical splice donor site	probably null
R1928:Vmn2r19	UTSW	6	123331630	missense	probably damaging	1.00
R1997:Vmn2r19	UTSW	6	123315921	missense	probably damaging	0.98
R2013:Vmn2r19	UTSW	6	123315995	missense	probably benign	0.01
R2015:Vmn2r19	UTSW	6	123315995	missense	probably benign	0.01
R2088:Vmn2r19	UTSW	6	123335836	missense	probably damaging	1.00
R2126:Vmn2r19	UTSW	6	123316074	missense	possibly damaging	0.82
R2128:Vmn2r19	UTSW	6	123308330	splice site	probably null
R2256:Vmn2r19	UTSW	6	123329886	missense	probably benign	0.20
R2517:Vmn2r19	UTSW	6	123329978	missense	probably benign	0.19
R3753:Vmn2r19	UTSW	6	123315589	missense	possibly damaging	0.80
R3817:Vmn2r19	UTSW	6	123309642	missense	probably damaging	1.00
R3934:Vmn2r19	UTSW	6	123315669	missense	probably damaging	1.00
R4232:Vmn2r19	UTSW	6	123329912	missense	probably benign
R4574:Vmn2r19	UTSW	6	123315980	missense	probably benign	0.01
R4886:Vmn2r19	UTSW	6	123309841	missense	probably benign	0.05
R4995:Vmn2r19	UTSW	6	123329910	missense	probably benign	0.00
R5107:Vmn2r19	UTSW	6	123309643	nonsense	probably null
R5232:Vmn2r19	UTSW	6	123335957	missense	probably benign
R6102:Vmn2r19	UTSW	6	123329948	missense	probably damaging	1.00
R6105:Vmn2r19	UTSW	6	123316095	missense	possibly damaging	0.70
R6280:Vmn2r19	UTSW	6	123336253	missense	probably benign
R6393:Vmn2r19	UTSW	6	123316153	missense	possibly damaging	0.80
R6502:Vmn2r19	UTSW	6	123316108	missense	possibly damaging	0.68
R6617:Vmn2r19	UTSW	6	123336535	makesense	probably null
R6742:Vmn2r19	UTSW	6	123329958	missense	possibly damaging	0.90
R7662:Vmn2r19	UTSW	6	123331562	missense	probably benign	0.33
R8041:Vmn2r19	UTSW	6	123335791	missense	possibly damaging	0.94
R8054:Vmn2r19	UTSW	6	123316039	missense	probably damaging	1.00
R8074:Vmn2r19	UTSW	6	123335945	missense	probably damaging	0.96
R8267:Vmn2r19	UTSW	6	123336262	missense	possibly damaging	0.50
R8287:Vmn2r19	UTSW	6	123331629	missense	probably damaging	1.00
R8937:Vmn2r19	UTSW	6	123316324	critical splice donor site	probably null
R9058:Vmn2r19	UTSW	6	123336062	missense	possibly damaging	0.53
R9119:Vmn2r19	UTSW	6	123315568	missense	possibly damaging	0.68
R9384:Vmn2r19	UTSW	6	123315964	missense	probably benign	0.00
X0058:Vmn2r19	UTSW	6	123308349	missense	probably benign	0.00
Z1088:Vmn2r19	UTSW	6	123308339	missense	probably benign	0.02
Z1177:Vmn2r19	UTSW	6	123336077	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- AGATAGACACTCCGTGACCCTG -3'
(R):5'- CACGTGTCAATGAGAATCTTTCC -3'

Sequencing Primer
(F):5'- ACACTCCGTGACCCTGTTTGATAC -3'
(R):5'- CCATAAAACGTTTCCTGTTTACTGTG -3'

Posted On

2015-04-17