Incidental Mutation 'R3929:Vmn2r19'
ID308631
Institutional Source Beutler Lab
Gene Symbol Vmn2r19
Ensembl Gene ENSMUSG00000091260
Gene Namevomeronasal 2, receptor 19
SynonymsEG232358
MMRRC Submission 040824-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R3929 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location123308333-123336537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123315628 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 210 (Y210H)
Ref Sequence ENSEMBL: ENSMUSP00000073604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073948]
Predicted Effect probably benign
Transcript: ENSMUST00000073948
AA Change: Y210H

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000073604
Gene: ENSMUSG00000091260
AA Change: Y210H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:ANF_receptor 81 476 2.9e-35 PFAM
Pfam:NCD3G 518 571 8.3e-23 PFAM
Pfam:7tm_3 603 839 7.2e-52 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 A C 3: 152,667,807 L18R probably damaging Het
Atrx T C X: 105,879,917 I157V possibly damaging Het
C9 T A 15: 6,467,458 I212N probably benign Het
Cabin1 T C 10: 75,751,618 probably null Het
Ccnf A G 17: 24,234,382 V361A probably damaging Het
Ctps T A 4: 120,541,896 H553L probably benign Het
Dmrta1 C T 4: 89,691,444 Q214* probably null Het
E230025N22Rik T C 18: 36,691,572 D112G probably damaging Het
Frat1 T C 19: 41,830,648 C161R probably damaging Het
H1foo A G 6: 115,948,796 K185E probably benign Het
Itpr2 C A 6: 146,374,359 probably null Het
Klhl40 A G 9: 121,780,676 D509G probably benign Het
Muc5ac T C 7: 141,802,892 V1072A probably benign Het
Nav3 A G 10: 109,684,203 Y2340H probably damaging Het
Olfr1105 T A 2: 87,034,084 I46F possibly damaging Het
Olfr1331 T C 4: 118,868,982 L66P probably damaging Het
Olfr1390 A T 11: 49,340,993 M154L probably benign Het
Olfr644 C T 7: 104,068,584 C149Y probably benign Het
Olfr791 G A 10: 129,526,231 M1I probably null Het
Prdm10 T C 9: 31,347,136 I619T probably damaging Het
Rp1 T C 1: 4,352,645 T71A probably damaging Het
Rpusd4 A G 9: 35,272,580 I202V probably benign Het
Sin3a A G 9: 57,118,137 N1089S probably damaging Het
St6gal2 A G 17: 55,496,323 D353G possibly damaging Het
Stap2 A C 17: 56,003,156 F50V probably damaging Het
Stkld1 T A 2: 26,940,047 probably null Het
Tarsl2 A G 7: 65,684,043 probably null Het
Tbl1xr1 G C 3: 22,189,768 D69H probably damaging Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trim61 A G 8: 65,013,317 F431L probably benign Het
Trmo C T 4: 46,382,647 G150S probably damaging Het
Vmn1r61 A G 7: 5,611,177 I46T probably benign Het
Xrn1 T C 9: 95,988,873 S584P possibly damaging Het
Other mutations in Vmn2r19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Vmn2r19 APN 6 123329867 missense possibly damaging 0.92
IGL02294:Vmn2r19 APN 6 123329978 missense probably benign 0.19
IGL02442:Vmn2r19 APN 6 123309662 missense possibly damaging 0.94
IGL02871:Vmn2r19 APN 6 123336083 missense probably damaging 1.00
H8562:Vmn2r19 UTSW 6 123315902 missense possibly damaging 0.82
R0025:Vmn2r19 UTSW 6 123331547 missense probably benign 0.01
R0389:Vmn2r19 UTSW 6 123335986 missense possibly damaging 0.53
R0402:Vmn2r19 UTSW 6 123336182 missense probably damaging 1.00
R0411:Vmn2r19 UTSW 6 123309744 missense probably damaging 0.98
R0554:Vmn2r19 UTSW 6 123336143 missense probably damaging 0.99
R0578:Vmn2r19 UTSW 6 123335972 missense probably damaging 1.00
R1102:Vmn2r19 UTSW 6 123336173 missense probably benign 0.28
R1652:Vmn2r19 UTSW 6 123315697 missense possibly damaging 0.68
R1663:Vmn2r19 UTSW 6 123336452 missense probably benign 0.11
R1817:Vmn2r19 UTSW 6 123330052 missense possibly damaging 0.80
R1866:Vmn2r19 UTSW 6 123331638 critical splice donor site probably null
R1928:Vmn2r19 UTSW 6 123331630 missense probably damaging 1.00
R1997:Vmn2r19 UTSW 6 123315921 missense probably damaging 0.98
R2013:Vmn2r19 UTSW 6 123315995 missense probably benign 0.01
R2015:Vmn2r19 UTSW 6 123315995 missense probably benign 0.01
R2088:Vmn2r19 UTSW 6 123335836 missense probably damaging 1.00
R2126:Vmn2r19 UTSW 6 123316074 missense possibly damaging 0.82
R2128:Vmn2r19 UTSW 6 123308330 unclassified probably null
R2256:Vmn2r19 UTSW 6 123329886 missense probably benign 0.20
R2517:Vmn2r19 UTSW 6 123329978 missense probably benign 0.19
R3753:Vmn2r19 UTSW 6 123315589 missense possibly damaging 0.80
R3817:Vmn2r19 UTSW 6 123309642 missense probably damaging 1.00
R3934:Vmn2r19 UTSW 6 123315669 missense probably damaging 1.00
R4232:Vmn2r19 UTSW 6 123329912 missense probably benign
R4574:Vmn2r19 UTSW 6 123315980 missense probably benign 0.01
R4886:Vmn2r19 UTSW 6 123309841 missense probably benign 0.05
R4995:Vmn2r19 UTSW 6 123329910 missense probably benign 0.00
R5107:Vmn2r19 UTSW 6 123309643 nonsense probably null
R5232:Vmn2r19 UTSW 6 123335957 missense probably benign
R6102:Vmn2r19 UTSW 6 123329948 missense probably damaging 1.00
R6105:Vmn2r19 UTSW 6 123316095 missense possibly damaging 0.70
R6280:Vmn2r19 UTSW 6 123336253 missense probably benign
R6393:Vmn2r19 UTSW 6 123316153 missense possibly damaging 0.80
R6502:Vmn2r19 UTSW 6 123316108 missense possibly damaging 0.68
R6617:Vmn2r19 UTSW 6 123336535 makesense probably null
R6742:Vmn2r19 UTSW 6 123329958 missense possibly damaging 0.90
R7662:Vmn2r19 UTSW 6 123331562 missense probably benign 0.33
R8041:Vmn2r19 UTSW 6 123335791 missense possibly damaging 0.94
R8054:Vmn2r19 UTSW 6 123316039 missense probably damaging 1.00
R8074:Vmn2r19 UTSW 6 123335945 missense probably damaging 0.96
R8267:Vmn2r19 UTSW 6 123336262 missense possibly damaging 0.50
R8287:Vmn2r19 UTSW 6 123331629 missense probably damaging 1.00
X0058:Vmn2r19 UTSW 6 123308349 missense probably benign 0.00
Z1088:Vmn2r19 UTSW 6 123308339 missense probably benign 0.02
Z1177:Vmn2r19 UTSW 6 123336077 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGATAGACACTCCGTGACCCTG -3'
(R):5'- CACGTGTCAATGAGAATCTTTCC -3'

Sequencing Primer
(F):5'- ACACTCCGTGACCCTGTTTGATAC -3'
(R):5'- CCATAAAACGTTTCCTGTTTACTGTG -3'
Posted On2015-04-17