Incidental Mutation 'R3929:Vmn1r61'
ID308633
Institutional Source Beutler Lab
Gene Symbol Vmn1r61
Ensembl Gene ENSMUSG00000094313
Gene Namevomeronasal 1 receptor 61
SynonymsGm7186
MMRRC Submission 040824-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R3929 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location5610251-5612068 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5611177 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 46 (I46T)
Ref Sequence ENSEMBL: ENSMUSP00000128012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164880]
Predicted Effect probably benign
Transcript: ENSMUST00000164880
AA Change: I46T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000128012
Gene: ENSMUSG00000094313
AA Change: I46T

DomainStartEndE-ValueType
Pfam:TAS2R 1 294 5.3e-12 PFAM
Pfam:7tm_1 20 279 5e-9 PFAM
Pfam:V1R 31 299 9.5e-21 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 A C 3: 152,667,807 L18R probably damaging Het
Atrx T C X: 105,879,917 I157V possibly damaging Het
C9 T A 15: 6,467,458 I212N probably benign Het
Cabin1 T C 10: 75,751,618 probably null Het
Ccnf A G 17: 24,234,382 V361A probably damaging Het
Ctps T A 4: 120,541,896 H553L probably benign Het
Dmrta1 C T 4: 89,691,444 Q214* probably null Het
E230025N22Rik T C 18: 36,691,572 D112G probably damaging Het
Frat1 T C 19: 41,830,648 C161R probably damaging Het
H1foo A G 6: 115,948,796 K185E probably benign Het
Itpr2 C A 6: 146,374,359 probably null Het
Klhl40 A G 9: 121,780,676 D509G probably benign Het
Muc5ac T C 7: 141,802,892 V1072A probably benign Het
Nav3 A G 10: 109,684,203 Y2340H probably damaging Het
Olfr1105 T A 2: 87,034,084 I46F possibly damaging Het
Olfr1331 T C 4: 118,868,982 L66P probably damaging Het
Olfr1390 A T 11: 49,340,993 M154L probably benign Het
Olfr644 C T 7: 104,068,584 C149Y probably benign Het
Olfr791 G A 10: 129,526,231 M1I probably null Het
Prdm10 T C 9: 31,347,136 I619T probably damaging Het
Rp1 T C 1: 4,352,645 T71A probably damaging Het
Rpusd4 A G 9: 35,272,580 I202V probably benign Het
Sin3a A G 9: 57,118,137 N1089S probably damaging Het
St6gal2 A G 17: 55,496,323 D353G possibly damaging Het
Stap2 A C 17: 56,003,156 F50V probably damaging Het
Stkld1 T A 2: 26,940,047 probably null Het
Tarsl2 A G 7: 65,684,043 probably null Het
Tbl1xr1 G C 3: 22,189,768 D69H probably damaging Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trim61 A G 8: 65,013,317 F431L probably benign Het
Trmo C T 4: 46,382,647 G150S probably damaging Het
Vmn2r19 T C 6: 123,315,628 Y210H probably benign Het
Xrn1 T C 9: 95,988,873 S584P possibly damaging Het
Other mutations in Vmn1r61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01700:Vmn1r61 APN 7 5611203 missense possibly damaging 0.82
IGL02859:Vmn1r61 APN 7 5611289 missense probably benign 0.37
IGL03344:Vmn1r61 APN 7 5610494 missense possibly damaging 0.95
R0189:Vmn1r61 UTSW 7 5610700 missense probably benign 0.03
R0336:Vmn1r61 UTSW 7 5611067 missense probably benign
R0616:Vmn1r61 UTSW 7 5610999 missense possibly damaging 0.65
R1490:Vmn1r61 UTSW 7 5611243 missense probably benign 0.00
R1737:Vmn1r61 UTSW 7 5611061 missense probably benign 0.01
R1755:Vmn1r61 UTSW 7 5611303 nonsense probably null
R1795:Vmn1r61 UTSW 7 5611325 utr 5 prime probably benign
R4487:Vmn1r61 UTSW 7 5610925 missense possibly damaging 0.76
R4629:Vmn1r61 UTSW 7 5611250 missense probably benign 0.08
R4785:Vmn1r61 UTSW 7 5611125 nonsense probably null
R4785:Vmn1r61 UTSW 7 5611127 missense probably benign
R5108:Vmn1r61 UTSW 7 5610520 missense probably benign
R5305:Vmn1r61 UTSW 7 5610815 missense probably damaging 1.00
R5914:Vmn1r61 UTSW 7 5610530 missense probably damaging 1.00
R6150:Vmn1r61 UTSW 7 5610679 missense probably benign 0.00
R6232:Vmn1r61 UTSW 7 5610851 missense probably damaging 1.00
R6722:Vmn1r61 UTSW 7 5610688 missense possibly damaging 0.55
R7488:Vmn1r61 UTSW 7 5610768 missense possibly damaging 0.56
R7496:Vmn1r61 UTSW 7 5610431 missense probably benign 0.19
R8353:Vmn1r61 UTSW 7 5610887 missense probably benign 0.11
R8453:Vmn1r61 UTSW 7 5610887 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGTGACAAACTGGTAGGTGCTG -3'
(R):5'- CAGCACTGTCTAACCTGATCC -3'

Sequencing Primer
(F):5'- CTGGTAGGTGCTGAGGACAC -3'
(R):5'- GATCCTTACACCACTGTGCTATGAAG -3'
Posted On2015-04-17