Incidental Mutation 'R3929:Rpusd4'
ID308641
Institutional Source Beutler Lab
Gene Symbol Rpusd4
Ensembl Gene ENSMUSG00000032044
Gene NameRNA pseudouridylate synthase domain containing 4
Synonyms2410001E19Rik
MMRRC Submission 040824-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R3929 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location35267865-35277731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35272580 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 202 (I202V)
Ref Sequence ENSEMBL: ENSMUSP00000034543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034543] [ENSMUST00000059057] [ENSMUST00000063782] [ENSMUST00000121564] [ENSMUST00000125087] [ENSMUST00000217306]
Predicted Effect probably benign
Transcript: ENSMUST00000034543
AA Change: I202V

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034543
Gene: ENSMUSG00000032044
AA Change: I202V

DomainStartEndE-ValueType
Pfam:PseudoU_synth_2 105 277 5.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059057
SMART Domains Protein: ENSMUSP00000058377
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
low complexity region 71 86 N/A INTRINSIC
Pfam:SIR2_2 157 301 1.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063782
SMART Domains Protein: ENSMUSP00000066281
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
Pfam:SIR2_2 75 225 7.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121564
SMART Domains Protein: ENSMUSP00000113537
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
low complexity region 71 86 N/A INTRINSIC
Pfam:SIR2_2 157 301 2.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125087
SMART Domains Protein: ENSMUSP00000119747
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
low complexity region 71 86 N/A INTRINSIC
Pfam:SIR2_2 157 268 3.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130552
Predicted Effect probably benign
Transcript: ENSMUST00000144582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147256
Predicted Effect probably benign
Transcript: ENSMUST00000217306
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 A C 3: 152,667,807 L18R probably damaging Het
Atrx T C X: 105,879,917 I157V possibly damaging Het
C9 T A 15: 6,467,458 I212N probably benign Het
Cabin1 T C 10: 75,751,618 probably null Het
Ccnf A G 17: 24,234,382 V361A probably damaging Het
Ctps T A 4: 120,541,896 H553L probably benign Het
Dmrta1 C T 4: 89,691,444 Q214* probably null Het
E230025N22Rik T C 18: 36,691,572 D112G probably damaging Het
Frat1 T C 19: 41,830,648 C161R probably damaging Het
H1foo A G 6: 115,948,796 K185E probably benign Het
Itpr2 C A 6: 146,374,359 probably null Het
Klhl40 A G 9: 121,780,676 D509G probably benign Het
Muc5ac T C 7: 141,802,892 V1072A probably benign Het
Nav3 A G 10: 109,684,203 Y2340H probably damaging Het
Olfr1105 T A 2: 87,034,084 I46F possibly damaging Het
Olfr1331 T C 4: 118,868,982 L66P probably damaging Het
Olfr1390 A T 11: 49,340,993 M154L probably benign Het
Olfr644 C T 7: 104,068,584 C149Y probably benign Het
Olfr791 G A 10: 129,526,231 M1I probably null Het
Prdm10 T C 9: 31,347,136 I619T probably damaging Het
Rp1 T C 1: 4,352,645 T71A probably damaging Het
Sin3a A G 9: 57,118,137 N1089S probably damaging Het
St6gal2 A G 17: 55,496,323 D353G possibly damaging Het
Stap2 A C 17: 56,003,156 F50V probably damaging Het
Stkld1 T A 2: 26,940,047 probably null Het
Tarsl2 A G 7: 65,684,043 probably null Het
Tbl1xr1 G C 3: 22,189,768 D69H probably damaging Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trim61 A G 8: 65,013,317 F431L probably benign Het
Trmo C T 4: 46,382,647 G150S probably damaging Het
Vmn1r61 A G 7: 5,611,177 I46T probably benign Het
Vmn2r19 T C 6: 123,315,628 Y210H probably benign Het
Xrn1 T C 9: 95,988,873 S584P possibly damaging Het
Other mutations in Rpusd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Rpusd4 APN 9 35268442 missense probably benign 0.34
IGL00722:Rpusd4 APN 9 35268418 missense possibly damaging 0.66
IGL01657:Rpusd4 APN 9 35273461 unclassified probably benign
IGL01780:Rpusd4 APN 9 35268424 missense probably damaging 0.98
IGL03290:Rpusd4 APN 9 35267977 missense probably benign
R0607:Rpusd4 UTSW 9 35267993 missense possibly damaging 0.93
R1081:Rpusd4 UTSW 9 35275088 missense probably benign 0.04
R1441:Rpusd4 UTSW 9 35272769 missense probably damaging 0.97
R2029:Rpusd4 UTSW 9 35268014 missense probably benign 0.00
R4107:Rpusd4 UTSW 9 35275128 missense probably damaging 1.00
R4840:Rpusd4 UTSW 9 35268535 missense probably damaging 1.00
R5429:Rpusd4 UTSW 9 35272602 missense probably benign 0.01
R5801:Rpusd4 UTSW 9 35270073 missense possibly damaging 0.83
R5988:Rpusd4 UTSW 9 35272520 splice site probably null
R6318:Rpusd4 UTSW 9 35268038 missense probably damaging 1.00
R7819:Rpusd4 UTSW 9 35267932 missense probably benign
R7995:Rpusd4 UTSW 9 35272721 missense probably damaging 0.99
V1662:Rpusd4 UTSW 9 35272761 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AACCTCTTTCACATAGAGAAGACACTG -3'
(R):5'- AAGCACCTGGTACTGCGTTAC -3'

Sequencing Primer
(F):5'- CTGTAAAAGTGTAGTAAAGATGGTCC -3'
(R):5'- GGCTGGCCCGTACCTTTAC -3'
Posted On2015-04-17