Incidental Mutation 'R3929:Olfr791'
ID308649
Institutional Source Beutler Lab
Gene Symbol Olfr791
Ensembl Gene ENSMUSG00000047626
Gene Nameolfactory receptor 791
SynonymsGA_x6K02T2PULF-11205096-11206034, MOR114-1
MMRRC Submission 040824-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R3929 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129521792-129528353 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) G to A at 129526231 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 1 (M1I)
Ref Sequence ENSEMBL: ENSMUSP00000150497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057477] [ENSMUST00000217228]
Predicted Effect probably null
Transcript: ENSMUST00000057477
AA Change: M1I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052722
Gene: ENSMUSG00000047626
AA Change: M1I

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 7.6e-45 PFAM
Pfam:7TM_GPCR_Srsx 33 303 4.3e-6 PFAM
Pfam:7tm_1 39 288 4.7e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000217228
AA Change: M1I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 A C 3: 152,667,807 L18R probably damaging Het
Atrx T C X: 105,879,917 I157V possibly damaging Het
C9 T A 15: 6,467,458 I212N probably benign Het
Cabin1 T C 10: 75,751,618 probably null Het
Ccnf A G 17: 24,234,382 V361A probably damaging Het
Ctps T A 4: 120,541,896 H553L probably benign Het
Dmrta1 C T 4: 89,691,444 Q214* probably null Het
E230025N22Rik T C 18: 36,691,572 D112G probably damaging Het
Frat1 T C 19: 41,830,648 C161R probably damaging Het
H1foo A G 6: 115,948,796 K185E probably benign Het
Itpr2 C A 6: 146,374,359 probably null Het
Klhl40 A G 9: 121,780,676 D509G probably benign Het
Muc5ac T C 7: 141,802,892 V1072A probably benign Het
Nav3 A G 10: 109,684,203 Y2340H probably damaging Het
Olfr1105 T A 2: 87,034,084 I46F possibly damaging Het
Olfr1331 T C 4: 118,868,982 L66P probably damaging Het
Olfr1390 A T 11: 49,340,993 M154L probably benign Het
Olfr644 C T 7: 104,068,584 C149Y probably benign Het
Prdm10 T C 9: 31,347,136 I619T probably damaging Het
Rp1 T C 1: 4,352,645 T71A probably damaging Het
Rpusd4 A G 9: 35,272,580 I202V probably benign Het
Sin3a A G 9: 57,118,137 N1089S probably damaging Het
St6gal2 A G 17: 55,496,323 D353G possibly damaging Het
Stap2 A C 17: 56,003,156 F50V probably damaging Het
Stkld1 T A 2: 26,940,047 probably null Het
Tarsl2 A G 7: 65,684,043 probably null Het
Tbl1xr1 G C 3: 22,189,768 D69H probably damaging Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trim61 A G 8: 65,013,317 F431L probably benign Het
Trmo C T 4: 46,382,647 G150S probably damaging Het
Vmn1r61 A G 7: 5,611,177 I46T probably benign Het
Vmn2r19 T C 6: 123,315,628 Y210H probably benign Het
Xrn1 T C 9: 95,988,873 S584P possibly damaging Het
Other mutations in Olfr791
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Olfr791 APN 10 129526995 missense probably damaging 0.97
IGL03034:Olfr791 APN 10 129526658 missense probably benign
IGL03281:Olfr791 APN 10 129526403 missense probably benign 0.31
R0555:Olfr791 UTSW 10 129526896 missense possibly damaging 0.90
R1474:Olfr791 UTSW 10 129526955 missense probably benign 0.03
R1638:Olfr791 UTSW 10 129526619 missense probably benign 0.00
R1917:Olfr791 UTSW 10 129527049 missense probably damaging 0.99
R1918:Olfr791 UTSW 10 129527049 missense probably damaging 0.99
R1919:Olfr791 UTSW 10 129527049 missense probably damaging 0.99
R2303:Olfr791 UTSW 10 129527049 missense probably benign 0.10
R3113:Olfr791 UTSW 10 129527143 missense probably benign 0.08
R4704:Olfr791 UTSW 10 129526302 missense possibly damaging 0.90
R4831:Olfr791 UTSW 10 129526580 missense probably damaging 1.00
R5207:Olfr791 UTSW 10 129526904 missense probably benign 0.08
R5313:Olfr791 UTSW 10 129527081 missense probably damaging 1.00
R5644:Olfr791 UTSW 10 129527103 missense probably damaging 1.00
R5661:Olfr791 UTSW 10 129526749 missense probably benign 0.45
R5894:Olfr791 UTSW 10 129526488 missense probably damaging 0.98
R6988:Olfr791 UTSW 10 129526673 missense probably benign 0.02
R6996:Olfr791 UTSW 10 129526863 missense probably damaging 1.00
R7380:Olfr791 UTSW 10 129526661 missense probably benign
R7539:Olfr791 UTSW 10 129527105 nonsense probably null
R7552:Olfr791 UTSW 10 129526560 missense possibly damaging 0.95
R7635:Olfr791 UTSW 10 129526682 missense probably benign 0.00
X0066:Olfr791 UTSW 10 129526745 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGACACCCTAAAGAGTAAC -3'
(R):5'- AGGTGATGGTATTGTCTCCAC -3'

Sequencing Primer
(F):5'- GGCTCTTTTACAATAATGTGAGTCC -3'
(R):5'- TGGTATTGTCTCCACTTGATATACTG -3'
Posted On2015-04-17