Incidental Mutation 'R0379:Vps33b'
ID30865
Institutional Source Beutler Lab
Gene Symbol Vps33b
Ensembl Gene ENSMUSG00000030534
Gene Namevacuolar protein sorting 33B
Synonyms
MMRRC Submission 038585-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0379 (G1)
Quality Score217
Status Validated
Chromosome7
Chromosomal Location80269649-80291754 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 80283414 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000032749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032749] [ENSMUST00000032749] [ENSMUST00000135053] [ENSMUST00000135053] [ENSMUST00000150585] [ENSMUST00000150585]
Predicted Effect probably null
Transcript: ENSMUST00000032749
SMART Domains Protein: ENSMUSP00000032749
Gene: ENSMUSG00000030534

DomainStartEndE-ValueType
Pfam:Sec1 37 611 2.4e-89 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000032749
SMART Domains Protein: ENSMUSP00000032749
Gene: ENSMUSG00000030534

DomainStartEndE-ValueType
Pfam:Sec1 37 611 2.4e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128254
Predicted Effect probably benign
Transcript: ENSMUST00000135053
SMART Domains Protein: ENSMUSP00000138472
Gene: ENSMUSG00000030534

DomainStartEndE-ValueType
SCOP:d1epua_ 18 59 2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135053
SMART Domains Protein: ENSMUSP00000138472
Gene: ENSMUSG00000030534

DomainStartEndE-ValueType
SCOP:d1epua_ 18 59 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145594
Predicted Effect probably benign
Transcript: ENSMUST00000150585
SMART Domains Protein: ENSMUSP00000138224
Gene: ENSMUSG00000030534

DomainStartEndE-ValueType
Pfam:Sec1 36 140 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150585
SMART Domains Protein: ENSMUSP00000138224
Gene: ENSMUSG00000030534

DomainStartEndE-ValueType
Pfam:Sec1 36 140 1.5e-12 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and encodes the human ortholog of rat Vps33b which is homologous to the yeast class C Vps33 protein. The mammalian class C vacuolar protein sorting proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Mutations in this gene are associated with arthrogryposis-renal dysfunction-cholestasis syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a conditional allele activated by an inducible cre exhibit dry scaly skin, hair loss, thrombocytosis, abnormal alpha-granule development, extramedullary hematopoiesis, abnormal platelets and megakaryocytes, and defects in tail tendon collagen I structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,785,546 probably benign Het
4930512M02Rik A G 11: 11,589,365 probably benign Het
Apba1 A C 19: 23,934,830 N558T probably damaging Het
Arfgef2 T A 2: 166,860,400 probably null Het
Arsb T C 13: 93,940,627 S501P probably benign Het
Atp10b A G 11: 43,254,314 T1295A probably benign Het
Atp8b5 G T 4: 43,361,898 R648L probably damaging Het
Bcl2a1b T C 9: 89,199,736 I126T possibly damaging Het
Brd9 T C 13: 73,942,683 probably benign Het
Cd93 T C 2: 148,441,510 probably benign Het
Chd5 A G 4: 152,383,321 K1692R probably benign Het
Clcn4 T C 7: 7,296,792 T13A probably damaging Het
Clec14a A G 12: 58,268,794 F14S possibly damaging Het
Clec4g A G 8: 3,718,440 V97A probably benign Het
Col24a1 G A 3: 145,524,142 R1483K possibly damaging Het
Crem A T 18: 3,299,226 V82D probably damaging Het
Ctnna2 T A 6: 77,641,440 T180S probably benign Het
Cybrd1 T C 2: 71,129,755 I99T probably benign Het
Cyp4a32 G A 4: 115,621,474 V468M probably damaging Het
Dlk1 A G 12: 109,455,059 probably benign Het
Dnah7b A T 1: 46,140,176 Y1003F probably benign Het
Egfem1 A C 3: 29,668,250 E376A possibly damaging Het
Etl4 T A 2: 20,807,354 I1416K probably damaging Het
Fbxl4 A G 4: 22,386,106 T238A probably benign Het
Fer1l6 A G 15: 58,548,338 I33M probably benign Het
Fndc3a A G 14: 72,556,609 S830P probably damaging Het
Fras1 C T 5: 96,755,509 R3082* probably null Het
Galnt13 T C 2: 55,060,492 V395A possibly damaging Het
Gm10334 T G 6: 41,445,256 probably benign Het
Gpd2 C T 2: 57,345,263 T335I probably damaging Het
Gucy2d C A 7: 98,459,002 probably null Het
Hydin A G 8: 110,509,127 probably benign Het
Ints5 G T 19: 8,897,133 V819L possibly damaging Het
Klhdc10 C G 6: 30,450,670 Q292E possibly damaging Het
Lmbrd2 G A 15: 9,149,479 A67T probably benign Het
Lrp1 T G 10: 127,594,969 T404P probably damaging Het
March7 T C 2: 60,234,126 S249P probably benign Het
Mcm10 T A 2: 5,008,623 K66M probably benign Het
Mtmr7 C A 8: 40,551,601 D645Y probably damaging Het
Muc6 T A 7: 141,636,955 I2602F possibly damaging Het
Myh13 G A 11: 67,369,295 probably benign Het
Myo18a G A 11: 77,850,806 V1776I possibly damaging Het
Ncapg2 T C 12: 116,443,075 L957S probably damaging Het
Ncoa3 T C 2: 166,054,502 S442P probably damaging Het
Olfr1093 G A 2: 86,785,735 E2K probably benign Het
Olfr850 T A 9: 19,477,480 T257S possibly damaging Het
Olfr986 G A 9: 40,187,433 G106D probably damaging Het
Pdcd6 G T 13: 74,309,712 N113K possibly damaging Het
Pfkfb4 C T 9: 109,027,742 probably benign Het
Pfkm A G 15: 98,126,314 H401R probably benign Het
Phldb2 C A 16: 45,781,451 D754Y probably damaging Het
Plekhb2 T A 1: 34,863,114 M49K probably damaging Het
Polrmt A G 10: 79,737,611 S1057P possibly damaging Het
Prps1l1 A G 12: 34,985,078 N64S probably benign Het
Psg16 T C 7: 17,130,658 S393P probably benign Het
Rundc1 C T 11: 101,425,147 T15I probably benign Het
Scaf11 A G 15: 96,431,816 L143S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpinf1 T G 11: 75,413,945 I197L probably benign Het
Siglec1 C T 2: 131,074,525 probably benign Het
Slc28a1 G A 7: 81,138,177 V271I probably benign Het
Sntg1 T C 1: 8,782,824 D34G probably damaging Het
Sptbn4 A T 7: 27,359,736 probably benign Het
Suclg1 T C 6: 73,256,228 I51T possibly damaging Het
Syne1 C T 10: 5,541,989 R9Q probably damaging Het
Trim47 T A 11: 116,106,518 H470L probably damaging Het
Ttc41 T A 10: 86,712,977 Y12N possibly damaging Het
Tubgcp2 T C 7: 140,032,192 E69G probably damaging Het
Tubgcp3 G A 8: 12,641,116 T474M probably damaging Het
Ubr5 A T 15: 38,018,957 N777K probably benign Het
Ush2a T C 1: 188,451,819 L1440P probably damaging Het
Usp28 A C 9: 49,024,067 D458A possibly damaging Het
Vcan A T 13: 89,703,546 D1098E probably damaging Het
Vmn1r73 C T 7: 11,756,846 T197I probably benign Het
Vmn2r15 T C 5: 109,286,478 S787G probably damaging Het
Vmn2r90 T A 17: 17,728,139 I549N probably damaging Het
Zfp516 A T 18: 82,987,670 K900* probably null Het
Zfp974 T A 7: 27,910,932 N456I probably damaging Het
Other mutations in Vps33b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Vps33b APN 7 80285843 missense probably damaging 1.00
IGL01352:Vps33b APN 7 80285059 splice site probably null
IGL01863:Vps33b APN 7 80274311 critical splice donor site probably null
IGL01918:Vps33b APN 7 80287812 splice site probably null
IGL02152:Vps33b APN 7 80285069 missense probably benign 0.29
IGL02364:Vps33b APN 7 80287839 missense probably damaging 1.00
IGL02383:Vps33b APN 7 80285334 splice site probably null
IGL02669:Vps33b APN 7 80276038 splice site probably benign
IGL03104:Vps33b APN 7 80276083 missense probably damaging 1.00
IGL03333:Vps33b APN 7 80274225 splice site probably benign
PIT4651001:Vps33b UTSW 7 80290007 missense probably damaging 0.99
R0267:Vps33b UTSW 7 80286054 missense possibly damaging 0.87
R0971:Vps33b UTSW 7 80287899 missense possibly damaging 0.75
R1184:Vps33b UTSW 7 80282486 missense probably benign 0.02
R1639:Vps33b UTSW 7 80284353 missense probably damaging 1.00
R1693:Vps33b UTSW 7 80287893 missense probably damaging 1.00
R4502:Vps33b UTSW 7 80287907 missense possibly damaging 0.94
R4609:Vps33b UTSW 7 80291118 missense probably benign 0.00
R4748:Vps33b UTSW 7 80290048 missense probably damaging 1.00
R5083:Vps33b UTSW 7 80274641 missense probably damaging 0.99
R5304:Vps33b UTSW 7 80274253 missense probably damaging 1.00
R5774:Vps33b UTSW 7 80285340 missense probably benign 0.38
R5991:Vps33b UTSW 7 80283414 splice site probably null
R7085:Vps33b UTSW 7 80276089 missense probably benign 0.12
R7409:Vps33b UTSW 7 80285269 missense probably damaging 0.97
R8025:Vps33b UTSW 7 80290346 splice site probably benign
R8460:Vps33b UTSW 7 80287869 missense probably benign 0.04
X0018:Vps33b UTSW 7 80290565 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GACAGTAGAACAGCTCATGATGGTCAG -3'
(R):5'- CTAGAAGCTCTTGCTTATCTGTCAGCC -3'

Sequencing Primer
(F):5'- ctttttccttctgtctcccttg -3'
(R):5'- GTCAGCCACACAGATTTTCC -3'
Posted On2013-04-24