Incidental Mutation 'R3879:Tnfrsf11a'
ID 308663
Institutional Source Beutler Lab
Gene Symbol Tnfrsf11a
Ensembl Gene ENSMUSG00000026321
Gene Name tumor necrosis factor receptor superfamily, member 11a, NFKB activator
Synonyms TRANCE-R, Rank
MMRRC Submission 040793-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.181) question?
Stock # R3879 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 105708443-105775709 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 105737085 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 64 (T64I)
Ref Sequence ENSEMBL: ENSMUSP00000027559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027559]
AlphaFold O35305
PDB Structure Crystal structure of mouse RANKL-RANK complex [X-RAY DIFFRACTION]
Crystal structure of mouse RANK [X-RAY DIFFRACTION]
Crystal structure of extracellular domains of mouse RANK-RANKL complex [X-RAY DIFFRACTION]
Crystal Structure of mouse RANK bound to RANKL [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027559
AA Change: T64I

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027559
Gene: ENSMUSG00000026321
AA Change: T64I

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
TNFR 35 69 1.48e-7 SMART
TNFR 72 113 2.59e-3 SMART
TNFR 115 152 4.28e-4 SMART
TNFR 155 195 5.27e-4 SMART
transmembrane domain 212 234 N/A INTRINSIC
low complexity region 300 313 N/A INTRINSIC
low complexity region 495 511 N/A INTRINSIC
low complexity region 543 558 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187812
Meta Mutation Damage Score 0.0899 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptors can interact with various TRAF family proteins, through which this receptor induces the activation of NF-kappa B and MAPK8/JNK. This receptor and its ligand are important regulators of the interaction between T cells and dendritic cells. This receptor is also an essential mediator for osteoclast and lymph node development. Mutations at this locus have been associated with familial expansile osteolysis, autosomal recessive osteopetrosis, and Paget disease of bone. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out or spontaneous allele exhibit a failure of tooth eruption, osteopetrosis, and abnormal immune system morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T C 3: 89,970,561 (GRCm39) probably benign Het
Aass G A 6: 23,122,520 (GRCm39) H68Y probably damaging Het
Abcc8 T A 7: 45,754,051 (GRCm39) K1588N possibly damaging Het
Calcoco1 T C 15: 102,615,823 (GRCm39) D601G probably damaging Het
Ccdc175 C A 12: 72,182,792 (GRCm39) R409I probably damaging Het
Ccnl1 A G 3: 65,856,179 (GRCm39) V242A possibly damaging Het
Clasp2 T C 9: 113,719,029 (GRCm39) F705L probably damaging Het
Cyp46a1 A G 12: 108,324,389 (GRCm39) T389A probably benign Het
Eps8 A G 6: 137,504,360 (GRCm39) probably benign Het
Gm9894 T C 13: 67,912,916 (GRCm39) noncoding transcript Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Nup153 A T 13: 46,837,436 (GRCm39) V1262E probably damaging Het
Nup210l A G 3: 90,092,780 (GRCm39) T1245A probably damaging Het
Or10ad1b C T 15: 98,125,085 (GRCm39) C147Y probably damaging Het
Or5b121 A G 19: 13,507,613 (GRCm39) Y236C probably damaging Het
Pcif1 G A 2: 164,727,878 (GRCm39) G189D probably benign Het
Pdzd2 A G 15: 12,375,594 (GRCm39) S1514P probably damaging Het
Pigu A T 2: 155,141,063 (GRCm39) F276I probably damaging Het
Pramex1 T C X: 134,514,194 (GRCm39) H365R probably benign Het
Psmd9 C T 5: 123,372,653 (GRCm39) probably benign Het
Rasgrp2 A T 19: 6,463,920 (GRCm39) Q539H probably benign Het
Rgs22 T G 15: 36,107,051 (GRCm39) I112L possibly damaging Het
Slc26a9 A T 1: 131,696,969 (GRCm39) T786S probably benign Het
Sned1 A G 1: 93,192,752 (GRCm39) probably benign Het
St7l G A 3: 104,833,763 (GRCm39) V475I probably damaging Het
Top3a A G 11: 60,634,765 (GRCm39) V713A possibly damaging Het
Trim16 G A 11: 62,731,433 (GRCm39) G348S probably damaging Het
Tshz3 C T 7: 36,470,962 (GRCm39) Q984* probably null Het
Ttn A G 2: 76,566,406 (GRCm39) probably null Het
Ubfd1 T A 7: 121,667,999 (GRCm39) probably benign Het
Zfp37 A T 4: 62,109,572 (GRCm39) Y497* probably null Het
Zfp462 G A 4: 55,060,095 (GRCm39) C1207Y probably damaging Het
Zfp607b A G 7: 27,403,476 (GRCm39) E644G possibly damaging Het
Other mutations in Tnfrsf11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Tnfrsf11a APN 1 105,737,147 (GRCm39) missense possibly damaging 0.80
IGL02429:Tnfrsf11a APN 1 105,755,443 (GRCm39) missense probably benign 0.14
IGL03222:Tnfrsf11a APN 1 105,749,215 (GRCm39) missense probably damaging 1.00
IGL03276:Tnfrsf11a APN 1 105,749,215 (GRCm39) missense probably damaging 1.00
PIT4354001:Tnfrsf11a UTSW 1 105,749,242 (GRCm39) missense probably damaging 1.00
R0321:Tnfrsf11a UTSW 1 105,772,583 (GRCm39) nonsense probably null
R0514:Tnfrsf11a UTSW 1 105,754,717 (GRCm39) missense probably damaging 1.00
R0655:Tnfrsf11a UTSW 1 105,735,880 (GRCm39) missense unknown
R1470:Tnfrsf11a UTSW 1 105,752,773 (GRCm39) missense probably damaging 0.96
R1470:Tnfrsf11a UTSW 1 105,752,773 (GRCm39) missense probably damaging 0.96
R1868:Tnfrsf11a UTSW 1 105,772,431 (GRCm39) missense probably damaging 1.00
R2900:Tnfrsf11a UTSW 1 105,754,786 (GRCm39) missense probably benign 0.03
R3418:Tnfrsf11a UTSW 1 105,737,130 (GRCm39) missense possibly damaging 0.84
R3816:Tnfrsf11a UTSW 1 105,737,085 (GRCm39) missense probably damaging 0.96
R3817:Tnfrsf11a UTSW 1 105,737,085 (GRCm39) missense probably damaging 0.96
R3818:Tnfrsf11a UTSW 1 105,737,085 (GRCm39) missense probably damaging 0.96
R3819:Tnfrsf11a UTSW 1 105,737,085 (GRCm39) missense probably damaging 0.96
R4037:Tnfrsf11a UTSW 1 105,755,464 (GRCm39) splice site probably null
R4039:Tnfrsf11a UTSW 1 105,755,464 (GRCm39) splice site probably null
R4238:Tnfrsf11a UTSW 1 105,754,962 (GRCm39) missense probably damaging 1.00
R5708:Tnfrsf11a UTSW 1 105,741,545 (GRCm39) splice site probably null
R6102:Tnfrsf11a UTSW 1 105,747,671 (GRCm39) missense possibly damaging 0.62
R6910:Tnfrsf11a UTSW 1 105,772,272 (GRCm39) missense probably damaging 1.00
R7169:Tnfrsf11a UTSW 1 105,772,421 (GRCm39) missense possibly damaging 0.95
R7178:Tnfrsf11a UTSW 1 105,755,264 (GRCm39) missense probably benign 0.04
R7293:Tnfrsf11a UTSW 1 105,735,866 (GRCm39) critical splice acceptor site probably null
R7323:Tnfrsf11a UTSW 1 105,772,456 (GRCm39) missense probably damaging 1.00
R7334:Tnfrsf11a UTSW 1 105,754,854 (GRCm39) missense possibly damaging 0.92
R7607:Tnfrsf11a UTSW 1 105,772,458 (GRCm39) missense probably benign 0.02
R7614:Tnfrsf11a UTSW 1 105,755,094 (GRCm39) missense probably damaging 1.00
R7651:Tnfrsf11a UTSW 1 105,737,171 (GRCm39) missense probably damaging 1.00
R7908:Tnfrsf11a UTSW 1 105,737,099 (GRCm39) missense probably damaging 1.00
R8078:Tnfrsf11a UTSW 1 105,745,409 (GRCm39) missense probably damaging 1.00
R8364:Tnfrsf11a UTSW 1 105,745,412 (GRCm39) missense probably damaging 0.99
R8859:Tnfrsf11a UTSW 1 105,772,244 (GRCm39) critical splice acceptor site probably null
R8979:Tnfrsf11a UTSW 1 105,754,825 (GRCm39) missense possibly damaging 0.78
R9008:Tnfrsf11a UTSW 1 105,754,854 (GRCm39) missense possibly damaging 0.92
R9016:Tnfrsf11a UTSW 1 105,754,854 (GRCm39) missense possibly damaging 0.92
R9017:Tnfrsf11a UTSW 1 105,754,854 (GRCm39) missense possibly damaging 0.92
R9052:Tnfrsf11a UTSW 1 105,754,854 (GRCm39) missense possibly damaging 0.92
Z1177:Tnfrsf11a UTSW 1 105,754,724 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCTTCCTGGATGAATGGTCC -3'
(R):5'- TGAGGAGAACCACTCAAAGC -3'

Sequencing Primer
(F):5'- GTCCTGTGAGTCAAATCTATAGGC -3'
(R):5'- GGGCATATTTAACAAGATCCTGTGG -3'
Posted On 2015-04-17