Incidental Mutation 'R3879:Pigu'
ID308666
Institutional Source Beutler Lab
Gene Symbol Pigu
Ensembl Gene ENSMUSG00000038383
Gene Namephosphatidylinositol glycan anchor biosynthesis, class U
SynonymsCdc91l1, 5430426F17Rik
MMRRC Submission 040793-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3879 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location155278243-155357430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 155299143 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 276 (F276I)
Ref Sequence ENSEMBL: ENSMUSP00000126236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077626] [ENSMUST00000165234]
Predicted Effect probably damaging
Transcript: ENSMUST00000077626
AA Change: F277I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076816
Gene: ENSMUSG00000038383
AA Change: F277I

DomainStartEndE-ValueType
Pfam:PIG-U 10 394 2.6e-119 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139854
Predicted Effect probably damaging
Transcript: ENSMUST00000165234
AA Change: F276I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126236
Gene: ENSMUSG00000038383
AA Change: F276I

DomainStartEndE-ValueType
Pfam:PIG-U 10 393 1.7e-116 PFAM
Meta Mutation Damage Score 0.5836 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with Saccharomyces cerevisiae Cdc91, a predicted integral membrane protein that may function in cell division control. The protein encoded by this gene is the fifth subunit of GPI transamidase that attaches GPI-anchors to proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T C 3: 90,063,254 probably benign Het
Aass G A 6: 23,122,521 H68Y probably damaging Het
Abcc8 T A 7: 46,104,627 K1588N possibly damaging Het
Calcoco1 T C 15: 102,707,388 D601G probably damaging Het
Ccdc175 C A 12: 72,136,018 R409I probably damaging Het
Ccnl1 A G 3: 65,948,758 V242A possibly damaging Het
Clasp2 T C 9: 113,889,961 F705L probably damaging Het
Cyp46a1 A G 12: 108,358,130 T389A probably benign Het
Eps8 A G 6: 137,527,362 probably benign Het
Gm9894 T C 13: 67,764,797 noncoding transcript Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Nup153 A T 13: 46,683,960 V1262E probably damaging Het
Nup210l A G 3: 90,185,473 T1245A probably damaging Het
Olfr1480 A G 19: 13,530,249 Y236C probably damaging Het
Olfr286 C T 15: 98,227,204 C147Y probably damaging Het
Pcif1 G A 2: 164,885,958 G189D probably benign Het
Pdzd2 A G 15: 12,375,508 S1514P probably damaging Het
Prame T C X: 135,613,445 H365R probably benign Het
Psmd9 C T 5: 123,234,590 probably benign Het
Rasgrp2 A T 19: 6,413,890 Q539H probably benign Het
Rgs22 T G 15: 36,106,905 I112L possibly damaging Het
Slc26a9 A T 1: 131,769,231 T786S probably benign Het
Sned1 A G 1: 93,265,030 probably benign Het
St7l G A 3: 104,926,447 V475I probably damaging Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Top3a A G 11: 60,743,939 V713A possibly damaging Het
Trim16 G A 11: 62,840,607 G348S probably damaging Het
Tshz3 C T 7: 36,771,537 Q984* probably null Het
Ttn A G 2: 76,736,062 probably null Het
Ubfd1 T A 7: 122,068,776 probably benign Het
Zfp37 A T 4: 62,191,335 Y497* probably null Het
Zfp462 G A 4: 55,060,095 C1207Y probably damaging Het
Zfp607b A G 7: 27,704,051 E644G possibly damaging Het
Other mutations in Pigu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02567:Pigu APN 2 155331192 missense possibly damaging 0.70
IGL02833:Pigu APN 2 155345645 splice site probably benign
IGL03213:Pigu APN 2 155335371 missense probably damaging 1.00
R1645:Pigu UTSW 2 155328678 nonsense probably null
R2426:Pigu UTSW 2 155299082 missense probably damaging 1.00
R3816:Pigu UTSW 2 155299143 missense probably damaging 1.00
R5017:Pigu UTSW 2 155299208 intron probably null
R5215:Pigu UTSW 2 155335329 intron probably benign
R5557:Pigu UTSW 2 155278629 nonsense probably null
R6106:Pigu UTSW 2 155297196 missense possibly damaging 0.67
R6718:Pigu UTSW 2 155301286 missense possibly damaging 0.49
R7140:Pigu UTSW 2 155301240 missense possibly damaging 0.78
R7358:Pigu UTSW 2 155299170 missense probably damaging 1.00
R7467:Pigu UTSW 2 155299089 missense probably damaging 1.00
R7503:Pigu UTSW 2 155331144 splice site probably null
R7844:Pigu UTSW 2 155292720 nonsense probably null
R7927:Pigu UTSW 2 155292720 nonsense probably null
Z1177:Pigu UTSW 2 155299148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAACTGCTGACCTGATCAATG -3'
(R):5'- ACTTTTAAAGGGACGGCGCC -3'

Sequencing Primer
(F):5'- TGCTGACCTGATCAATGAAGCC -3'
(R):5'- CATCCTTGGTCACCTAGTACTGG -3'
Posted On2015-04-17