Incidental Mutation 'R3879:Zfp37'
ID308674
Institutional Source Beutler Lab
Gene Symbol Zfp37
Ensembl Gene ENSMUSG00000028389
Gene Namezinc finger protein 37
SynonymsZfp-37, Tzn
MMRRC Submission 040793-MU
Accession Numbers

Genbank: NM_009554.3; Ensembl: ENSMUST00000068822

Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R3879 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location62189540-62231047 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 62191335 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 497 (Y497*)
Ref Sequence ENSEMBL: ENSMUSP00000152400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068822] [ENSMUST00000129511] [ENSMUST00000220873] [ENSMUST00000221329] [ENSMUST00000222050] [ENSMUST00000222748]
Predicted Effect probably null
Transcript: ENSMUST00000068822
AA Change: Y538*
SMART Domains Protein: ENSMUSP00000070463
Gene: ENSMUSG00000028389
AA Change: Y538*

DomainStartEndE-ValueType
KRAB 13 62 5.89e-12 SMART
low complexity region 113 122 N/A INTRINSIC
ZnF_C2H2 255 277 2.75e-3 SMART
ZnF_C2H2 283 305 3.95e-4 SMART
ZnF_C2H2 311 333 2.2e-2 SMART
ZnF_C2H2 339 361 8.02e-5 SMART
ZnF_C2H2 367 389 1.13e-4 SMART
ZnF_C2H2 395 417 9.88e-5 SMART
ZnF_C2H2 423 445 2.61e-4 SMART
ZnF_C2H2 451 473 6.08e-5 SMART
ZnF_C2H2 479 501 5.99e-4 SMART
ZnF_C2H2 507 529 5.99e-4 SMART
ZnF_C2H2 535 557 1.03e-2 SMART
ZnF_C2H2 563 585 9.88e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000129511
AA Change: Y184*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148664
Predicted Effect probably null
Transcript: ENSMUST00000220873
AA Change: Y497*
Predicted Effect probably null
Transcript: ENSMUST00000221329
AA Change: Y535*
Predicted Effect probably null
Transcript: ENSMUST00000222050
AA Change: Y534*
Predicted Effect probably null
Transcript: ENSMUST00000222748
AA Change: Y497*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that belongs to a large family of zinc finger proteins. A similar protein in mouse is thought to play a role in regulating the structures of the nucleolus and centromere in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T C 3: 90,063,254 probably benign Het
Aass G A 6: 23,122,521 H68Y probably damaging Het
Abcc8 T A 7: 46,104,627 K1588N possibly damaging Het
Calcoco1 T C 15: 102,707,388 D601G probably damaging Het
Ccdc175 C A 12: 72,136,018 R409I probably damaging Het
Ccnl1 A G 3: 65,948,758 V242A possibly damaging Het
Clasp2 T C 9: 113,889,961 F705L probably damaging Het
Cyp46a1 A G 12: 108,358,130 T389A probably benign Het
Eps8 A G 6: 137,527,362 probably benign Het
Gm9894 T C 13: 67,764,797 noncoding transcript Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Nup153 A T 13: 46,683,960 V1262E probably damaging Het
Nup210l A G 3: 90,185,473 T1245A probably damaging Het
Olfr1480 A G 19: 13,530,249 Y236C probably damaging Het
Olfr286 C T 15: 98,227,204 C147Y probably damaging Het
Pcif1 G A 2: 164,885,958 G189D probably benign Het
Pdzd2 A G 15: 12,375,508 S1514P probably damaging Het
Pigu A T 2: 155,299,143 F276I probably damaging Het
Prame T C X: 135,613,445 H365R probably benign Het
Psmd9 C T 5: 123,234,590 probably benign Het
Rasgrp2 A T 19: 6,413,890 Q539H probably benign Het
Rgs22 T G 15: 36,106,905 I112L possibly damaging Het
Slc26a9 A T 1: 131,769,231 T786S probably benign Het
Sned1 A G 1: 93,265,030 probably benign Het
St7l G A 3: 104,926,447 V475I probably damaging Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Top3a A G 11: 60,743,939 V713A possibly damaging Het
Trim16 G A 11: 62,840,607 G348S probably damaging Het
Tshz3 C T 7: 36,771,537 Q984* probably null Het
Ttn A G 2: 76,736,062 probably null Het
Ubfd1 T A 7: 122,068,776 probably benign Het
Zfp462 G A 4: 55,060,095 C1207Y probably damaging Het
Zfp607b A G 7: 27,704,051 E644G possibly damaging Het
Other mutations in Zfp37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02742:Zfp37 APN 4 62192311 missense possibly damaging 0.69
B6584:Zfp37 UTSW 4 62191378 missense probably damaging 1.00
R0383:Zfp37 UTSW 4 62191885 start codon destroyed probably null 0.61
R0457:Zfp37 UTSW 4 62191665 nonsense probably null
R1258:Zfp37 UTSW 4 62191817 missense probably damaging 1.00
R2072:Zfp37 UTSW 4 62191708 missense probably damaging 1.00
R2073:Zfp37 UTSW 4 62191708 missense probably damaging 1.00
R2261:Zfp37 UTSW 4 62191636 missense probably damaging 1.00
R2262:Zfp37 UTSW 4 62191636 missense probably damaging 1.00
R2507:Zfp37 UTSW 4 62191256 missense probably damaging 1.00
R2897:Zfp37 UTSW 4 62191777 missense probably damaging 1.00
R2898:Zfp37 UTSW 4 62191777 missense probably damaging 1.00
R3826:Zfp37 UTSW 4 62192563 missense probably benign 0.00
R4034:Zfp37 UTSW 4 62191696 missense probably damaging 1.00
R4491:Zfp37 UTSW 4 62192128 missense probably benign 0.07
R4823:Zfp37 UTSW 4 62191503 missense probably benign 0.18
R5186:Zfp37 UTSW 4 62191256 missense probably damaging 1.00
R5650:Zfp37 UTSW 4 62191765 missense probably damaging 1.00
R5886:Zfp37 UTSW 4 62191234 missense probably damaging 1.00
R5925:Zfp37 UTSW 4 62191213 missense possibly damaging 0.47
R7050:Zfp37 UTSW 4 62191671 missense possibly damaging 0.72
R7553:Zfp37 UTSW 4 62191999 missense probably damaging 1.00
R7583:Zfp37 UTSW 4 62192016 start gained probably benign
R7646:Zfp37 UTSW 4 62191295 missense probably damaging 0.99
R8061:Zfp37 UTSW 4 62191428 nonsense probably null
X0026:Zfp37 UTSW 4 62205089 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGTCAGTTGTCAGGTTTCCTAC -3'
(R):5'- CTCATCTCTTACCTACCATATGAGAAC -3'

Sequencing Primer
(F):5'- CAGTTGTCAGGTTTCCTACATTAATC -3'
(R):5'- GCCCCTTTGAATGTAATCAATGTGG -3'
Posted On2015-04-17