Incidental Mutation 'R0379:Tubgcp3'
ID30869
Institutional Source Beutler Lab
Gene Symbol Tubgcp3
Ensembl Gene ENSMUSG00000000759
Gene Nametubulin, gamma complex associated protein 3
SynonymsSpc98p, GCP3
MMRRC Submission 038585-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R0379 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location12614277-12672248 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12641116 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 474 (T474M)
Ref Sequence ENSEMBL: ENSMUSP00000000776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000776] [ENSMUST00000164774]
Predicted Effect probably damaging
Transcript: ENSMUST00000000776
AA Change: T474M

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000000776
Gene: ENSMUSG00000000759
AA Change: T474M

DomainStartEndE-ValueType
low complexity region 152 171 N/A INTRINSIC
Pfam:Spc97_Spc98 251 761 9.5e-124 PFAM
coiled coil region 787 814 N/A INTRINSIC
low complexity region 821 827 N/A INTRINSIC
low complexity region 890 903 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164611
Predicted Effect probably benign
Transcript: ENSMUST00000164774
SMART Domains Protein: ENSMUSP00000127741
Gene: ENSMUSG00000000759

DomainStartEndE-ValueType
low complexity region 152 171 N/A INTRINSIC
Pfam:Spc97_Spc98 251 361 3.5e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168657
Meta Mutation Damage Score 0.4531 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency 98% (79/81)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,785,546 probably benign Het
4930512M02Rik A G 11: 11,589,365 probably benign Het
Apba1 A C 19: 23,934,830 N558T probably damaging Het
Arfgef2 T A 2: 166,860,400 probably null Het
Arsb T C 13: 93,940,627 S501P probably benign Het
Atp10b A G 11: 43,254,314 T1295A probably benign Het
Atp8b5 G T 4: 43,361,898 R648L probably damaging Het
Bcl2a1b T C 9: 89,199,736 I126T possibly damaging Het
Brd9 T C 13: 73,942,683 probably benign Het
Cd93 T C 2: 148,441,510 probably benign Het
Chd5 A G 4: 152,383,321 K1692R probably benign Het
Clcn4 T C 7: 7,296,792 T13A probably damaging Het
Clec14a A G 12: 58,268,794 F14S possibly damaging Het
Clec4g A G 8: 3,718,440 V97A probably benign Het
Col24a1 G A 3: 145,524,142 R1483K possibly damaging Het
Crem A T 18: 3,299,226 V82D probably damaging Het
Ctnna2 T A 6: 77,641,440 T180S probably benign Het
Cybrd1 T C 2: 71,129,755 I99T probably benign Het
Cyp4a32 G A 4: 115,621,474 V468M probably damaging Het
Dlk1 A G 12: 109,455,059 probably benign Het
Dnah7b A T 1: 46,140,176 Y1003F probably benign Het
Egfem1 A C 3: 29,668,250 E376A possibly damaging Het
Etl4 T A 2: 20,807,354 I1416K probably damaging Het
Fbxl4 A G 4: 22,386,106 T238A probably benign Het
Fer1l6 A G 15: 58,548,338 I33M probably benign Het
Fndc3a A G 14: 72,556,609 S830P probably damaging Het
Fras1 C T 5: 96,755,509 R3082* probably null Het
Galnt13 T C 2: 55,060,492 V395A possibly damaging Het
Gm10334 T G 6: 41,445,256 probably benign Het
Gpd2 C T 2: 57,345,263 T335I probably damaging Het
Gucy2d C A 7: 98,459,002 probably null Het
Hydin A G 8: 110,509,127 probably benign Het
Ints5 G T 19: 8,897,133 V819L possibly damaging Het
Klhdc10 C G 6: 30,450,670 Q292E possibly damaging Het
Lmbrd2 G A 15: 9,149,479 A67T probably benign Het
Lrp1 T G 10: 127,594,969 T404P probably damaging Het
March7 T C 2: 60,234,126 S249P probably benign Het
Mcm10 T A 2: 5,008,623 K66M probably benign Het
Mtmr7 C A 8: 40,551,601 D645Y probably damaging Het
Muc6 T A 7: 141,636,955 I2602F possibly damaging Het
Myh13 G A 11: 67,369,295 probably benign Het
Myo18a G A 11: 77,850,806 V1776I possibly damaging Het
Ncapg2 T C 12: 116,443,075 L957S probably damaging Het
Ncoa3 T C 2: 166,054,502 S442P probably damaging Het
Olfr1093 G A 2: 86,785,735 E2K probably benign Het
Olfr850 T A 9: 19,477,480 T257S possibly damaging Het
Olfr986 G A 9: 40,187,433 G106D probably damaging Het
Pdcd6 G T 13: 74,309,712 N113K possibly damaging Het
Pfkfb4 C T 9: 109,027,742 probably benign Het
Pfkm A G 15: 98,126,314 H401R probably benign Het
Phldb2 C A 16: 45,781,451 D754Y probably damaging Het
Plekhb2 T A 1: 34,863,114 M49K probably damaging Het
Polrmt A G 10: 79,737,611 S1057P possibly damaging Het
Prps1l1 A G 12: 34,985,078 N64S probably benign Het
Psg16 T C 7: 17,130,658 S393P probably benign Het
Rundc1 C T 11: 101,425,147 T15I probably benign Het
Scaf11 A G 15: 96,431,816 L143S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpinf1 T G 11: 75,413,945 I197L probably benign Het
Siglec1 C T 2: 131,074,525 probably benign Het
Slc28a1 G A 7: 81,138,177 V271I probably benign Het
Sntg1 T C 1: 8,782,824 D34G probably damaging Het
Sptbn4 A T 7: 27,359,736 probably benign Het
Suclg1 T C 6: 73,256,228 I51T possibly damaging Het
Syne1 C T 10: 5,541,989 R9Q probably damaging Het
Trim47 T A 11: 116,106,518 H470L probably damaging Het
Ttc41 T A 10: 86,712,977 Y12N possibly damaging Het
Tubgcp2 T C 7: 140,032,192 E69G probably damaging Het
Ubr5 A T 15: 38,018,957 N777K probably benign Het
Ush2a T C 1: 188,451,819 L1440P probably damaging Het
Usp28 A C 9: 49,024,067 D458A possibly damaging Het
Vcan A T 13: 89,703,546 D1098E probably damaging Het
Vmn1r73 C T 7: 11,756,846 T197I probably benign Het
Vmn2r15 T C 5: 109,286,478 S787G probably damaging Het
Vmn2r90 T A 17: 17,728,139 I549N probably damaging Het
Vps33b T A 7: 80,283,414 probably null Het
Zfp516 A T 18: 82,987,670 K900* probably null Het
Zfp974 T A 7: 27,910,932 N456I probably damaging Het
Other mutations in Tubgcp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Tubgcp3 APN 8 12621809 missense probably benign 0.00
IGL00583:Tubgcp3 APN 8 12621906 nonsense probably null
IGL01289:Tubgcp3 APN 8 12639625 missense probably damaging 1.00
IGL01578:Tubgcp3 APN 8 12661297 splice site probably benign
IGL01716:Tubgcp3 APN 8 12641094 splice site probably benign
IGL01943:Tubgcp3 APN 8 12654301 missense probably damaging 1.00
IGL02020:Tubgcp3 APN 8 12637780 missense possibly damaging 0.46
IGL02345:Tubgcp3 APN 8 12625056 missense probably damaging 1.00
IGL02555:Tubgcp3 APN 8 12639595 missense probably benign 0.36
IGL02644:Tubgcp3 APN 8 12648733 missense probably damaging 1.00
IGL02976:Tubgcp3 APN 8 12632300 missense probably damaging 1.00
IGL03240:Tubgcp3 APN 8 12649797 missense probably benign 0.07
IGL03287:Tubgcp3 APN 8 12639630 missense possibly damaging 0.77
Tinky_winky UTSW 8 12650171 missense probably damaging 1.00
R0145:Tubgcp3 UTSW 8 12657561 missense probably benign 0.01
R0558:Tubgcp3 UTSW 8 12653462 missense probably benign 0.00
R1490:Tubgcp3 UTSW 8 12639550 missense probably damaging 1.00
R1709:Tubgcp3 UTSW 8 12639532 nonsense probably null
R1768:Tubgcp3 UTSW 8 12649686 unclassified probably benign
R1921:Tubgcp3 UTSW 8 12621932 nonsense probably null
R1928:Tubgcp3 UTSW 8 12663988 missense possibly damaging 0.94
R2161:Tubgcp3 UTSW 8 12632292 missense probably benign 0.22
R3120:Tubgcp3 UTSW 8 12657626 missense possibly damaging 0.51
R3434:Tubgcp3 UTSW 8 12658381 splice site probably null
R4011:Tubgcp3 UTSW 8 12639634 nonsense probably null
R4162:Tubgcp3 UTSW 8 12639547 missense possibly damaging 0.46
R4300:Tubgcp3 UTSW 8 12657600 missense probably damaging 0.99
R4350:Tubgcp3 UTSW 8 12641117 missense probably benign 0.19
R4529:Tubgcp3 UTSW 8 12663932 missense probably damaging 0.98
R4530:Tubgcp3 UTSW 8 12663932 missense probably damaging 0.98
R4531:Tubgcp3 UTSW 8 12663932 missense probably damaging 0.98
R4676:Tubgcp3 UTSW 8 12650171 missense probably damaging 1.00
R4730:Tubgcp3 UTSW 8 12657654 missense probably benign 0.03
R4828:Tubgcp3 UTSW 8 12671987 missense probably benign
R4860:Tubgcp3 UTSW 8 12649722 missense probably benign 0.03
R4860:Tubgcp3 UTSW 8 12649722 missense probably benign 0.03
R5610:Tubgcp3 UTSW 8 12639577 missense probably damaging 1.00
R5625:Tubgcp3 UTSW 8 12624888 missense possibly damaging 0.46
R5650:Tubgcp3 UTSW 8 12648670 missense probably damaging 0.98
R5775:Tubgcp3 UTSW 8 12625056 missense probably damaging 1.00
R6257:Tubgcp3 UTSW 8 12649835 splice site probably null
R6314:Tubgcp3 UTSW 8 12648625 missense probably benign 0.02
R6970:Tubgcp3 UTSW 8 12637000 missense probably damaging 0.98
R7173:Tubgcp3 UTSW 8 12639259 splice site probably null
R7408:Tubgcp3 UTSW 8 12661359 nonsense probably null
R7502:Tubgcp3 UTSW 8 12641207 missense probably damaging 0.99
R7701:Tubgcp3 UTSW 8 12655974 missense probably benign
R7739:Tubgcp3 UTSW 8 12657561 missense probably benign 0.01
R8169:Tubgcp3 UTSW 8 12616099 missense probably benign
R8327:Tubgcp3 UTSW 8 12654343 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGCAAGCATACATCAGCATGGTCC -3'
(R):5'- TAAGTCTCCACGGAGAGGTGCAAC -3'

Sequencing Primer
(F):5'- TCAGCATGGTCCATTAGCAG -3'
(R):5'- gtccacctgcctctgcc -3'
Posted On2013-04-24