Incidental Mutation 'R3879:Gm9894'
ID308692
Institutional Source Beutler Lab
Gene Symbol Gm9894
Ensembl Gene ENSMUSG00000052909
Gene Namepredicted gene 9894
Synonyms
MMRRC Submission 040793-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R3879 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location67764247-67765065 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to C at 67764797 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171257
SMART Domains Protein: ENSMUSP00000125787
Gene: ENSMUSG00000052909

DomainStartEndE-ValueType
KRAB 5 65 9.53e-30 SMART
ZnF_C2H2 109 132 7.15e-2 SMART
ZnF_C2H2 138 160 8.34e-3 SMART
ZnF_C2H2 166 188 5.4e1 SMART
ZnF_C2H2 194 216 9.96e-1 SMART
ZnF_C2H2 222 244 1.18e-2 SMART
ZnF_C2H2 278 300 2.57e-3 SMART
ZnF_C2H2 306 328 5.26e1 SMART
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (38/40)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T C 3: 90,063,254 probably benign Het
Aass G A 6: 23,122,521 H68Y probably damaging Het
Abcc8 T A 7: 46,104,627 K1588N possibly damaging Het
Calcoco1 T C 15: 102,707,388 D601G probably damaging Het
Ccdc175 C A 12: 72,136,018 R409I probably damaging Het
Ccnl1 A G 3: 65,948,758 V242A possibly damaging Het
Clasp2 T C 9: 113,889,961 F705L probably damaging Het
Cyp46a1 A G 12: 108,358,130 T389A probably benign Het
Eps8 A G 6: 137,527,362 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Nup153 A T 13: 46,683,960 V1262E probably damaging Het
Nup210l A G 3: 90,185,473 T1245A probably damaging Het
Olfr1480 A G 19: 13,530,249 Y236C probably damaging Het
Olfr286 C T 15: 98,227,204 C147Y probably damaging Het
Pcif1 G A 2: 164,885,958 G189D probably benign Het
Pdzd2 A G 15: 12,375,508 S1514P probably damaging Het
Pigu A T 2: 155,299,143 F276I probably damaging Het
Prame T C X: 135,613,445 H365R probably benign Het
Psmd9 C T 5: 123,234,590 probably benign Het
Rasgrp2 A T 19: 6,413,890 Q539H probably benign Het
Rgs22 T G 15: 36,106,905 I112L possibly damaging Het
Slc26a9 A T 1: 131,769,231 T786S probably benign Het
Sned1 A G 1: 93,265,030 probably benign Het
St7l G A 3: 104,926,447 V475I probably damaging Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Top3a A G 11: 60,743,939 V713A possibly damaging Het
Trim16 G A 11: 62,840,607 G348S probably damaging Het
Tshz3 C T 7: 36,771,537 Q984* probably null Het
Ttn A G 2: 76,736,062 probably null Het
Ubfd1 T A 7: 122,068,776 probably benign Het
Zfp37 A T 4: 62,191,335 Y497* probably null Het
Zfp462 G A 4: 55,060,095 C1207Y probably damaging Het
Zfp607b A G 7: 27,704,051 E644G possibly damaging Het
Other mutations in Gm9894
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Gm9894 APN 13 67765117 exon noncoding transcript
IGL02474:Gm9894 APN 13 67765094 exon noncoding transcript
R0412:Gm9894 UTSW 13 67765026 exon noncoding transcript
R1170:Gm9894 UTSW 13 67764701 exon noncoding transcript
R1604:Gm9894 UTSW 13 67764889 exon noncoding transcript
R1617:Gm9894 UTSW 13 67772726 critical splice donor site noncoding transcript
R1961:Gm9894 UTSW 13 67763915 exon noncoding transcript
R4450:Gm9894 UTSW 13 67765080 exon noncoding transcript
R4666:Gm9894 UTSW 13 67765094 exon noncoding transcript
R6020:Gm9894 UTSW 13 67763835 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- CTCCAGTATGAGCTATTTTGTGTTC -3'
(R):5'- GGCCTTTGATTGTAACTCACTC -3'

Sequencing Primer
(F):5'- TCCATAAAGGTTACACTTGTAGGG -3'
(R):5'- TCCTACAAGTGTGAAGACTCTGGC -3'
Posted On2015-04-17